ID: 1000800145

View in Genome Browser
Species Human (GRCh38)
Location 5:165715528-165715550
Sequence TTGAGGATCTTCAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000800137_1000800145 6 Left 1000800137 5:165715499-165715521 CCTGGGGCAAGTATTCAGCCCTA No data
Right 1000800145 5:165715528-165715550 TTGAGGATCTTCAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000800145 Original CRISPR TTGAGGATCTTCAGGGAGCA GGG Intergenic
No off target data available for this crispr