ID: 1000801634

View in Genome Browser
Species Human (GRCh38)
Location 5:165734778-165734800
Sequence GGCCCCAACACAATAATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000801634_1000801637 30 Left 1000801634 5:165734778-165734800 CCAACTATTATTGTGTTGGGGCC No data
Right 1000801637 5:165734831-165734853 ATATGTGGTCTCTCAAATGTTGG No data
1000801634_1000801636 15 Left 1000801634 5:165734778-165734800 CCAACTATTATTGTGTTGGGGCC No data
Right 1000801636 5:165734816-165734838 CAATATTTGATTTGTATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000801634 Original CRISPR GGCCCCAACACAATAATAGT TGG (reversed) Intergenic
No off target data available for this crispr