ID: 1000807709

View in Genome Browser
Species Human (GRCh38)
Location 5:165817182-165817204
Sequence ATTGTGGAGCAGAATGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000807705_1000807709 13 Left 1000807705 5:165817146-165817168 CCTGGGAGAACAAAGTATAAACA No data
Right 1000807709 5:165817182-165817204 ATTGTGGAGCAGAATGAGTTAGG No data
1000807704_1000807709 23 Left 1000807704 5:165817136-165817158 CCATGTTTGTCCTGGGAGAACAA No data
Right 1000807709 5:165817182-165817204 ATTGTGGAGCAGAATGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000807709 Original CRISPR ATTGTGGAGCAGAATGAGTT AGG Intergenic
No off target data available for this crispr