ID: 1000808381

View in Genome Browser
Species Human (GRCh38)
Location 5:165827101-165827123
Sequence TAGGGTTACAATAATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000808369_1000808381 4 Left 1000808369 5:165827074-165827096 CCACCGGAAGTCACTTCACCCAG No data
Right 1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG No data
1000808367_1000808381 14 Left 1000808367 5:165827064-165827086 CCCTTTAAGTCCACCGGAAGTCA No data
Right 1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG No data
1000808370_1000808381 1 Left 1000808370 5:165827077-165827099 CCGGAAGTCACTTCACCCAGAGG No data
Right 1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG No data
1000808368_1000808381 13 Left 1000808368 5:165827065-165827087 CCTTTAAGTCCACCGGAAGTCAC No data
Right 1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000808381 Original CRISPR TAGGGTTACAATAATGGGGG AGG Intergenic
No off target data available for this crispr