ID: 1000813124 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:165887380-165887402 |
| Sequence | CTAGGGTTTCCCAGAGAAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1000813119_1000813124 | 13 | Left | 1000813119 | 5:165887344-165887366 | CCTCATCCAATCAGTTGAAGGTC | 0: 34 1: 233 2: 625 3: 850 4: 994 |
||
| Right | 1000813124 | 5:165887380-165887402 | CTAGGGTTTCCCAGAGAAGGAGG | No data | ||||
| 1000813120_1000813124 | 7 | Left | 1000813120 | 5:165887350-165887372 | CCAATCAGTTGAAGGTCTTCAGA | No data | ||
| Right | 1000813124 | 5:165887380-165887402 | CTAGGGTTTCCCAGAGAAGGAGG | No data | ||||
| 1000813117_1000813124 | 29 | Left | 1000813117 | 5:165887328-165887350 | CCATAATCTGGGTGGGCCTCATC | No data | ||
| Right | 1000813124 | 5:165887380-165887402 | CTAGGGTTTCCCAGAGAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1000813124 | Original CRISPR | CTAGGGTTTCCCAGAGAAGG AGG | Intergenic | ||
| No off target data available for this crispr | |||||