ID: 1000813124

View in Genome Browser
Species Human (GRCh38)
Location 5:165887380-165887402
Sequence CTAGGGTTTCCCAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000813119_1000813124 13 Left 1000813119 5:165887344-165887366 CCTCATCCAATCAGTTGAAGGTC 0: 34
1: 233
2: 625
3: 850
4: 994
Right 1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG No data
1000813120_1000813124 7 Left 1000813120 5:165887350-165887372 CCAATCAGTTGAAGGTCTTCAGA No data
Right 1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG No data
1000813117_1000813124 29 Left 1000813117 5:165887328-165887350 CCATAATCTGGGTGGGCCTCATC No data
Right 1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000813124 Original CRISPR CTAGGGTTTCCCAGAGAAGG AGG Intergenic
No off target data available for this crispr