ID: 1000817014

View in Genome Browser
Species Human (GRCh38)
Location 5:165936101-165936123
Sequence CCCATTTGCTAGCATTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000817011_1000817014 -5 Left 1000817011 5:165936083-165936105 CCTTCTTTCCTCTGGGGTCCCAT No data
Right 1000817014 5:165936101-165936123 CCCATTTGCTAGCATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000817014 Original CRISPR CCCATTTGCTAGCATTGCCC AGG Intergenic
No off target data available for this crispr