ID: 1000817927

View in Genome Browser
Species Human (GRCh38)
Location 5:165946654-165946676
Sequence TACCATAGAAAGAGTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000817925_1000817927 -1 Left 1000817925 5:165946632-165946654 CCCATTTAACATCATTATAGTTT No data
Right 1000817927 5:165946654-165946676 TACCATAGAAAGAGTGTGCCTGG No data
1000817924_1000817927 19 Left 1000817924 5:165946612-165946634 CCTACTCATATATTCTCGAGCCC No data
Right 1000817927 5:165946654-165946676 TACCATAGAAAGAGTGTGCCTGG No data
1000817926_1000817927 -2 Left 1000817926 5:165946633-165946655 CCATTTAACATCATTATAGTTTA No data
Right 1000817927 5:165946654-165946676 TACCATAGAAAGAGTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000817927 Original CRISPR TACCATAGAAAGAGTGTGCC TGG Intergenic
No off target data available for this crispr