ID: 1000821506

View in Genome Browser
Species Human (GRCh38)
Location 5:165990286-165990308
Sequence GTGCATGTAGACCAAAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000821506_1000821513 18 Left 1000821506 5:165990286-165990308 CCCCCACTTTGGTCTACATGCAC No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000821506 Original CRISPR GTGCATGTAGACCAAAGTGG GGG (reversed) Intergenic
No off target data available for this crispr