ID: 1000821513

View in Genome Browser
Species Human (GRCh38)
Location 5:165990327-165990349
Sequence GATGCCACAGAGAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000821500_1000821513 26 Left 1000821500 5:165990278-165990300 CCCCGCCCCCCCCACTTTGGTCT No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821504_1000821513 20 Left 1000821504 5:165990284-165990306 CCCCCCCACTTTGGTCTACATGC No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821509_1000821513 15 Left 1000821509 5:165990289-165990311 CCACTTTGGTCTACATGCACACT No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821501_1000821513 25 Left 1000821501 5:165990279-165990301 CCCGCCCCCCCCACTTTGGTCTA No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821508_1000821513 16 Left 1000821508 5:165990288-165990310 CCCACTTTGGTCTACATGCACAC No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821502_1000821513 24 Left 1000821502 5:165990280-165990302 CCGCCCCCCCCACTTTGGTCTAC No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821503_1000821513 21 Left 1000821503 5:165990283-165990305 CCCCCCCCACTTTGGTCTACATG No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821506_1000821513 18 Left 1000821506 5:165990286-165990308 CCCCCACTTTGGTCTACATGCAC No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821507_1000821513 17 Left 1000821507 5:165990287-165990309 CCCCACTTTGGTCTACATGCACA No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data
1000821505_1000821513 19 Left 1000821505 5:165990285-165990307 CCCCCCACTTTGGTCTACATGCA No data
Right 1000821513 5:165990327-165990349 GATGCCACAGAGAGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000821513 Original CRISPR GATGCCACAGAGAGAGAAGT TGG Intergenic
No off target data available for this crispr