ID: 1000825053

View in Genome Browser
Species Human (GRCh38)
Location 5:166034712-166034734
Sequence CACGGTGCCCAGCTGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000825053_1000825064 18 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825064 5:166034753-166034775 AGAACTCTGGGAGGCTGAGGAGG 0: 47
1: 2826
2: 70569
3: 158285
4: 158695
1000825053_1000825066 22 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825066 5:166034757-166034779 CTCTGGGAGGCTGAGGAGGGTGG 0: 57
1: 3092
2: 54269
3: 150969
4: 188060
1000825053_1000825058 6 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825058 5:166034741-166034763 GCCTATAATCCCAGAACTCTGGG 0: 18
1: 1306
2: 33637
3: 270410
4: 274456
1000825053_1000825062 15 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825062 5:166034750-166034772 CCCAGAACTCTGGGAGGCTGAGG 0: 72
1: 4358
2: 99283
3: 220809
4: 243070
1000825053_1000825057 5 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825057 5:166034740-166034762 AGCCTATAATCCCAGAACTCTGG No data
1000825053_1000825060 9 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825060 5:166034744-166034766 TATAATCCCAGAACTCTGGGAGG 0: 27
1: 1768
2: 44282
3: 347997
4: 251957
1000825053_1000825065 19 Left 1000825053 5:166034712-166034734 CCAGGTTCCAGCTGGGCACCGTG No data
Right 1000825065 5:166034754-166034776 GAACTCTGGGAGGCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000825053 Original CRISPR CACGGTGCCCAGCTGGAACC TGG (reversed) Intergenic
No off target data available for this crispr