ID: 1000827577

View in Genome Browser
Species Human (GRCh38)
Location 5:166065085-166065107
Sequence CATGATATGAAGTGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000827577_1000827579 5 Left 1000827577 5:166065085-166065107 CCAGAAACACACTTCATATCATG No data
Right 1000827579 5:166065113-166065135 AGTATTTCTTTTTCTGTTTTTGG No data
1000827577_1000827580 22 Left 1000827577 5:166065085-166065107 CCAGAAACACACTTCATATCATG No data
Right 1000827580 5:166065130-166065152 TTTTGGTCATAGCCTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000827577 Original CRISPR CATGATATGAAGTGTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr