ID: 1000833739

View in Genome Browser
Species Human (GRCh38)
Location 5:166132005-166132027
Sequence GCACACCTCCCAGCTAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000833739_1000833750 21 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833750 5:166132049-166132071 AAGGGGGCCGTTAGTGATGAGGG No data
1000833739_1000833743 -7 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833743 5:166132021-166132043 GGTGTGCGGCCTGAAGGAGTTGG 0: 3
1: 5
2: 6
3: 14
4: 149
1000833739_1000833745 2 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833745 5:166132030-166132052 CCTGAAGGAGTTGGTAAATAAGG 0: 10
1: 5
2: 2
3: 52
4: 709
1000833739_1000833752 30 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833752 5:166132058-166132080 GTTAGTGATGAGGGTTCCTTTGG No data
1000833739_1000833749 20 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833749 5:166132048-166132070 TAAGGGGGCCGTTAGTGATGAGG No data
1000833739_1000833746 3 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833746 5:166132031-166132053 CTGAAGGAGTTGGTAAATAAGGG 0: 11
1: 4
2: 4
3: 20
4: 208
1000833739_1000833748 5 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833748 5:166132033-166132055 GAAGGAGTTGGTAAATAAGGGGG 0: 9
1: 4
2: 1
3: 23
4: 235
1000833739_1000833747 4 Left 1000833739 5:166132005-166132027 CCCGTTTTAGCTGGGAGGTGTGC No data
Right 1000833747 5:166132032-166132054 TGAAGGAGTTGGTAAATAAGGGG 0: 10
1: 4
2: 3
3: 21
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000833739 Original CRISPR GCACACCTCCCAGCTAAAAC GGG (reversed) Intergenic
No off target data available for this crispr