ID: 1000835904

View in Genome Browser
Species Human (GRCh38)
Location 5:166153854-166153876
Sequence TAGAAAAAGGAAAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000835904_1000835907 3 Left 1000835904 5:166153854-166153876 CCAGCCTCATTTTCCTTTTTCTA No data
Right 1000835907 5:166153880-166153902 ATCACTTAATAGTCCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000835904 Original CRISPR TAGAAAAAGGAAAATGAGGC TGG (reversed) Intergenic
No off target data available for this crispr