ID: 1000841198

View in Genome Browser
Species Human (GRCh38)
Location 5:166220627-166220649
Sequence TTGTCTATGAACAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000841198_1000841203 16 Left 1000841198 5:166220627-166220649 CCTGCTTCCTTGTTCATAGACAA No data
Right 1000841203 5:166220666-166220688 TCATATGGCCAAAGGAACAAAGG No data
1000841198_1000841201 8 Left 1000841198 5:166220627-166220649 CCTGCTTCCTTGTTCATAGACAA No data
Right 1000841201 5:166220658-166220680 CTGTATCCTCATATGGCCAAAGG No data
1000841198_1000841200 1 Left 1000841198 5:166220627-166220649 CCTGCTTCCTTGTTCATAGACAA No data
Right 1000841200 5:166220651-166220673 GATCTTGCTGTATCCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000841198 Original CRISPR TTGTCTATGAACAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr