ID: 1000842035

View in Genome Browser
Species Human (GRCh38)
Location 5:166231968-166231990
Sequence TTGGTTAAACACAGGCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000842035_1000842038 23 Left 1000842035 5:166231968-166231990 CCTCTATGCCTGTGTTTAACCAA No data
Right 1000842038 5:166232014-166232036 CATCTCCCAGATTGTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000842035 Original CRISPR TTGGTTAAACACAGGCATAG AGG (reversed) Intergenic
No off target data available for this crispr