ID: 1000844603

View in Genome Browser
Species Human (GRCh38)
Location 5:166264087-166264109
Sequence CAGTATAATTAGATTAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000844603_1000844606 -4 Left 1000844603 5:166264087-166264109 CCCCACTTAATCTAATTATACTG No data
Right 1000844606 5:166264106-166264128 ACTGTTCTGAAGATTTATAGAGG No data
1000844603_1000844608 21 Left 1000844603 5:166264087-166264109 CCCCACTTAATCTAATTATACTG No data
Right 1000844608 5:166264131-166264153 AGGTAGTAGAAATAATTTTCTGG No data
1000844603_1000844607 1 Left 1000844603 5:166264087-166264109 CCCCACTTAATCTAATTATACTG No data
Right 1000844607 5:166264111-166264133 TCTGAAGATTTATAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000844603 Original CRISPR CAGTATAATTAGATTAAGTG GGG (reversed) Intergenic
No off target data available for this crispr