ID: 1000846612

View in Genome Browser
Species Human (GRCh38)
Location 5:166289568-166289590
Sequence CAGGATATACAGATGAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000846606_1000846612 17 Left 1000846606 5:166289528-166289550 CCTCTACTGGCACATGACTGACC No data
Right 1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG No data
1000846608_1000846612 -4 Left 1000846608 5:166289549-166289571 CCCTCTTGCAAGTCTGGCTCAGG No data
Right 1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG No data
1000846610_1000846612 -5 Left 1000846610 5:166289550-166289572 CCTCTTGCAAGTCTGGCTCAGGA No data
Right 1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000846612 Original CRISPR CAGGATATACAGATGAATAA GGG Intergenic
No off target data available for this crispr