ID: 1000850569

View in Genome Browser
Species Human (GRCh38)
Location 5:166335151-166335173
Sequence CTGAAAACACTGAGGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000850569_1000850579 27 Left 1000850569 5:166335151-166335173 CCCAGCTACCTCAGTGTTTTCAG No data
Right 1000850579 5:166335201-166335223 GTGGTAATTTGGCAATGTAAAGG No data
1000850569_1000850573 8 Left 1000850569 5:166335151-166335173 CCCAGCTACCTCAGTGTTTTCAG No data
Right 1000850573 5:166335182-166335204 GATGTTGCCCCTACCATATGTGG No data
1000850569_1000850580 28 Left 1000850569 5:166335151-166335173 CCCAGCTACCTCAGTGTTTTCAG No data
Right 1000850580 5:166335202-166335224 TGGTAATTTGGCAATGTAAAGGG No data
1000850569_1000850576 16 Left 1000850569 5:166335151-166335173 CCCAGCTACCTCAGTGTTTTCAG No data
Right 1000850576 5:166335190-166335212 CCCTACCATATGTGGTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000850569 Original CRISPR CTGAAAACACTGAGGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr