ID: 1000852056

View in Genome Browser
Species Human (GRCh38)
Location 5:166352503-166352525
Sequence GTGCCCACCACTTCTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000852055_1000852056 -10 Left 1000852055 5:166352490-166352512 CCAGCAGTGAAGCGTGCCCACCA No data
Right 1000852056 5:166352503-166352525 GTGCCCACCACTTCTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000852056 Original CRISPR GTGCCCACCACTTCTAAAGC TGG Intergenic
No off target data available for this crispr