ID: 1000855065

View in Genome Browser
Species Human (GRCh38)
Location 5:166387995-166388017
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000855059_1000855065 24 Left 1000855059 5:166387948-166387970 CCTGCTAAAATGGCTGATACTGC No data
Right 1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000855065 Original CRISPR CTTTAAACAAAGTTGAGGCT GGG Intergenic
No off target data available for this crispr