ID: 1000870661

View in Genome Browser
Species Human (GRCh38)
Location 5:166573232-166573254
Sequence CAGGCACAGAATGCTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000870652_1000870661 25 Left 1000870652 5:166573184-166573206 CCCAAGGTCTTCCTTGGCAGCAG No data
Right 1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG No data
1000870657_1000870661 14 Left 1000870657 5:166573195-166573217 CCTTGGCAGCAGGAACCAGGGTA No data
Right 1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG No data
1000870653_1000870661 24 Left 1000870653 5:166573185-166573207 CCAAGGTCTTCCTTGGCAGCAGG No data
Right 1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG No data
1000870658_1000870661 -1 Left 1000870658 5:166573210-166573232 CCAGGGTAAACAGTAGTCTTTCC No data
Right 1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000870661 Original CRISPR CAGGCACAGAATGCTGAGTG TGG Intergenic
No off target data available for this crispr