ID: 1000873996

View in Genome Browser
Species Human (GRCh38)
Location 5:166612988-166613010
Sequence CTGCTGGCATTGAGGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000873996_1000873999 -9 Left 1000873996 5:166612988-166613010 CCTTGCTTCCTCAATGCCAGCAG No data
Right 1000873999 5:166613002-166613024 TGCCAGCAGGAGAGAATCTGCGG No data
1000873996_1000874001 2 Left 1000873996 5:166612988-166613010 CCTTGCTTCCTCAATGCCAGCAG No data
Right 1000874001 5:166613013-166613035 GAGAATCTGCGGCTTCTACAAGG No data
1000873996_1000874003 30 Left 1000873996 5:166612988-166613010 CCTTGCTTCCTCAATGCCAGCAG No data
Right 1000874003 5:166613041-166613063 ATCTCCAGACCTTCTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000873996 Original CRISPR CTGCTGGCATTGAGGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr