ID: 1000877376

View in Genome Browser
Species Human (GRCh38)
Location 5:166657602-166657624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000877374_1000877376 12 Left 1000877374 5:166657567-166657589 CCGAAAGGAATGCTAATGTGATA No data
Right 1000877376 5:166657602-166657624 AAGCTGATCGAAAGAACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000877376 Original CRISPR AAGCTGATCGAAAGAACATA GGG Intergenic
No off target data available for this crispr