ID: 1000882424

View in Genome Browser
Species Human (GRCh38)
Location 5:166713694-166713716
Sequence TTCTTTCAATGTAAGACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000882422_1000882424 1 Left 1000882422 5:166713670-166713692 CCAGTGTGATATGTATATTGGTA No data
Right 1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000882424 Original CRISPR TTCTTTCAATGTAAGACCTA GGG Intergenic
No off target data available for this crispr