ID: 1000886004

View in Genome Browser
Species Human (GRCh38)
Location 5:166747969-166747991
Sequence AAGGCTACTCATACCACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000886001_1000886004 28 Left 1000886001 5:166747918-166747940 CCATTCACAATAGAAATAAGAAA No data
Right 1000886004 5:166747969-166747991 AAGGCTACTCATACCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000886004 Original CRISPR AAGGCTACTCATACCACCCA TGG Intergenic
No off target data available for this crispr