ID: 1000888275

View in Genome Browser
Species Human (GRCh38)
Location 5:166773466-166773488
Sequence GTGGCAATAACAGGGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000888272_1000888275 -8 Left 1000888272 5:166773451-166773473 CCTGAAATAGTCTTTGTGGCAAT No data
Right 1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG No data
1000888270_1000888275 14 Left 1000888270 5:166773429-166773451 CCTGGGCATGTCTTCTAGGGCTC No data
Right 1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000888275 Original CRISPR GTGGCAATAACAGGGCATCC AGG Intergenic
No off target data available for this crispr