ID: 1000891920

View in Genome Browser
Species Human (GRCh38)
Location 5:166810929-166810951
Sequence CTAAGGCTGTGCCACTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000891916_1000891920 18 Left 1000891916 5:166810888-166810910 CCTGTGTTGTTTGTGATATCAGA No data
Right 1000891920 5:166810929-166810951 CTAAGGCTGTGCCACTCTGTAGG No data
1000891914_1000891920 23 Left 1000891914 5:166810883-166810905 CCAGCCCTGTGTTGTTTGTGATA No data
Right 1000891920 5:166810929-166810951 CTAAGGCTGTGCCACTCTGTAGG No data
1000891915_1000891920 19 Left 1000891915 5:166810887-166810909 CCCTGTGTTGTTTGTGATATCAG No data
Right 1000891920 5:166810929-166810951 CTAAGGCTGTGCCACTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000891920 Original CRISPR CTAAGGCTGTGCCACTCTGT AGG Intergenic