ID: 1000895230

View in Genome Browser
Species Human (GRCh38)
Location 5:166847275-166847297
Sequence GTGTGTGCACGTGTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000895227_1000895230 -10 Left 1000895227 5:166847262-166847284 CCTACATTCTATTGTGTGTGCAC No data
Right 1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000895230 Original CRISPR GTGTGTGCACGTGTGTGTTG GGG Intergenic
No off target data available for this crispr