ID: 1000900608

View in Genome Browser
Species Human (GRCh38)
Location 5:166907523-166907545
Sequence CTATGTCAGGGTAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000900601_1000900608 15 Left 1000900601 5:166907485-166907507 CCTATTTTGATTTGGAAATAGTG No data
Right 1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG No data
1000900600_1000900608 20 Left 1000900600 5:166907480-166907502 CCGTGCCTATTTTGATTTGGAAA No data
Right 1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000900608 Original CRISPR CTATGTCAGGGTAAGGTGGA GGG Intergenic
No off target data available for this crispr