ID: 1000900739

View in Genome Browser
Species Human (GRCh38)
Location 5:166909039-166909061
Sequence GTAAGATAAAGGCAATGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000900731_1000900739 22 Left 1000900731 5:166908994-166909016 CCATGAAAATATATGAAAAACGC No data
Right 1000900739 5:166909039-166909061 GTAAGATAAAGGCAATGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000900739 Original CRISPR GTAAGATAAAGGCAATGGTG GGG Intergenic
No off target data available for this crispr