ID: 1000908152

View in Genome Browser
Species Human (GRCh38)
Location 5:166988729-166988751
Sequence TCCAGTGTGAGGGACATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000908152_1000908159 7 Left 1000908152 5:166988729-166988751 CCCTCCATGTCCCTCACACTGGA No data
Right 1000908159 5:166988759-166988781 TGCCATGAGCATCACCCACACGG No data
1000908152_1000908163 24 Left 1000908152 5:166988729-166988751 CCCTCCATGTCCCTCACACTGGA No data
Right 1000908163 5:166988776-166988798 ACACGGCTGCCCTAGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000908152 Original CRISPR TCCAGTGTGAGGGACATGGA GGG (reversed) Intergenic
No off target data available for this crispr