ID: 1000918949

View in Genome Browser
Species Human (GRCh38)
Location 5:167116164-167116186
Sequence AAGGATAAACAGAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000918943_1000918949 26 Left 1000918943 5:167116115-167116137 CCAAAATGGGATTGTACATGCAA No data
Right 1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000918949 Original CRISPR AAGGATAAACAGAAGGAAGT AGG Intergenic
No off target data available for this crispr