ID: 1000924378

View in Genome Browser
Species Human (GRCh38)
Location 5:167176003-167176025
Sequence GAAAGACCACAGATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000924378_1000924380 9 Left 1000924378 5:167176003-167176025 CCCAGCTGTATCTGTGGTCTTTC No data
Right 1000924380 5:167176035-167176057 AACCTTTCCACGAAGTTGCCAGG No data
1000924378_1000924384 28 Left 1000924378 5:167176003-167176025 CCCAGCTGTATCTGTGGTCTTTC No data
Right 1000924384 5:167176054-167176076 CAGGTTACTTCATAAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000924378 Original CRISPR GAAAGACCACAGATACAGCT GGG (reversed) Intergenic
No off target data available for this crispr