ID: 1000924917

View in Genome Browser
Species Human (GRCh38)
Location 5:167181532-167181554
Sequence TGTTATATGTGTTGACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000924917_1000924918 20 Left 1000924917 5:167181532-167181554 CCTTTAGGTCAACACATATAACA No data
Right 1000924918 5:167181575-167181597 ACGCAATATTTAAATGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000924917 Original CRISPR TGTTATATGTGTTGACCTAA AGG (reversed) Intergenic
No off target data available for this crispr