ID: 1000926663

View in Genome Browser
Species Human (GRCh38)
Location 5:167202646-167202668
Sequence CTGTGTGACTGGGAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000926663_1000926670 -9 Left 1000926663 5:167202646-167202668 CCATCATCCTCCCAGTCACACAG No data
Right 1000926670 5:167202660-167202682 GTCACACAGGTGTGGCTCCTGGG No data
1000926663_1000926673 27 Left 1000926663 5:167202646-167202668 CCATCATCCTCCCAGTCACACAG No data
Right 1000926673 5:167202696-167202718 GAGATCCATTACCCCAAATCAGG No data
1000926663_1000926669 -10 Left 1000926663 5:167202646-167202668 CCATCATCCTCCCAGTCACACAG No data
Right 1000926669 5:167202659-167202681 AGTCACACAGGTGTGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000926663 Original CRISPR CTGTGTGACTGGGAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr