ID: 1000927596

View in Genome Browser
Species Human (GRCh38)
Location 5:167212840-167212862
Sequence TCCTATGTGCATATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000927596_1000927604 17 Left 1000927596 5:167212840-167212862 CCCTACTCCATATGCACATAGGA No data
Right 1000927604 5:167212880-167212902 ACATCTTTAACAAGTATTGCCGG No data
1000927596_1000927603 -10 Left 1000927596 5:167212840-167212862 CCCTACTCCATATGCACATAGGA No data
Right 1000927603 5:167212853-167212875 GCACATAGGAGGAGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000927596 Original CRISPR TCCTATGTGCATATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr