ID: 1000927596 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:167212840-167212862 |
| Sequence | TCCTATGTGCATATGGAGTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1000927596_1000927604 | 17 | Left | 1000927596 | 5:167212840-167212862 | CCCTACTCCATATGCACATAGGA | No data | ||
| Right | 1000927604 | 5:167212880-167212902 | ACATCTTTAACAAGTATTGCCGG | No data | ||||
| 1000927596_1000927603 | -10 | Left | 1000927596 | 5:167212840-167212862 | CCCTACTCCATATGCACATAGGA | No data | ||
| Right | 1000927603 | 5:167212853-167212875 | GCACATAGGAGGAGAGCTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1000927596 | Original CRISPR | TCCTATGTGCATATGGAGTA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||