ID: 1000930427

View in Genome Browser
Species Human (GRCh38)
Location 5:167244738-167244760
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000930423_1000930427 18 Left 1000930423 5:167244697-167244719 CCTCCGAGGGATAGGTGCTGGGC No data
Right 1000930427 5:167244738-167244760 TGGTGTCTCTCAGTCTCCCAAGG No data
1000930424_1000930427 15 Left 1000930424 5:167244700-167244722 CCGAGGGATAGGTGCTGGGCTTT No data
Right 1000930427 5:167244738-167244760 TGGTGTCTCTCAGTCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000930427 Original CRISPR TGGTGTCTCTCAGTCTCCCA AGG Intergenic
No off target data available for this crispr