ID: 1000933939

View in Genome Browser
Species Human (GRCh38)
Location 5:167285399-167285421
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 479}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000933939_1000933944 27 Left 1000933939 5:167285399-167285421 CCCTTTTCCCTCTACTAAAATAT 0: 1
1: 0
2: 1
3: 48
4: 479
Right 1000933944 5:167285449-167285471 CTTTTTGTGTTTCAGAGCATGGG No data
1000933939_1000933943 26 Left 1000933939 5:167285399-167285421 CCCTTTTCCCTCTACTAAAATAT 0: 1
1: 0
2: 1
3: 48
4: 479
Right 1000933943 5:167285448-167285470 TCTTTTTGTGTTTCAGAGCATGG 0: 1
1: 0
2: 3
3: 45
4: 458
1000933939_1000933945 30 Left 1000933939 5:167285399-167285421 CCCTTTTCCCTCTACTAAAATAT 0: 1
1: 0
2: 1
3: 48
4: 479
Right 1000933945 5:167285452-167285474 TTTGTGTTTCAGAGCATGGGTGG 0: 1
1: 0
2: 4
3: 16
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000933939 Original CRISPR ATATTTTAGTAGAGGGAAAA GGG (reversed) Intronic
902229442 1:15018618-15018640 CTAATTTAGTAGAGGAAGAAAGG - Intronic
903567168 1:24276463-24276485 AAATTTTAGAAAAGGGAAAATGG - Intergenic
904216760 1:28926726-28926748 AGATTTTATCAAAGGGAAAAGGG - Intronic
905298928 1:36972831-36972853 CTAGTCTAGTAGAGAGAAAAGGG - Intronic
905549645 1:38825995-38826017 ATATTTTAAAAGAGGTAAATGGG - Intergenic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
906234553 1:44197324-44197346 ATCTTTAAGAAGATGGAAAATGG - Intergenic
906876416 1:49543412-49543434 ACATTCTAGGAGAGGAAAAAGGG + Intronic
907164890 1:52401635-52401657 ATATTTAAGAATAGGCAAAATGG + Intronic
907507332 1:54929384-54929406 ATATGTTTGTATAGGGATAAGGG + Intergenic
907831149 1:58065472-58065494 ATATTTTAGTAAAGGGAACTGGG + Intronic
909659586 1:78067273-78067295 ACATTTTATTAGTGAGAAAATGG - Intronic
910647609 1:89530549-89530571 ATATTTTTGTAGAGGGCCAGAGG + Intronic
910753203 1:90656946-90656968 TTATTTTAGTAGAGTAAAAGAGG - Intergenic
910879262 1:91907769-91907791 ATATTTTAATAGAGTCAAGATGG - Intergenic
911244538 1:95502261-95502283 ATACTTCAGGAGTGGGAAAAAGG + Intergenic
911405060 1:97426718-97426740 ATATTTTAGTAAAGGCAAAGAGG + Intronic
911443281 1:97957284-97957306 ACAACGTAGTAGAGGGAAAATGG + Intergenic
911496222 1:98634818-98634840 ATAATATAGAAGAGGGTAAAAGG + Intergenic
911660303 1:100493978-100494000 ATTTTTCAGTTGAGGAAAAAAGG + Intronic
913198636 1:116478134-116478156 ATATTGCAGGAGAGGGAAACAGG + Intergenic
913681278 1:121188266-121188288 ATTTTTCAGGAGAGGGAAATGGG - Intronic
914033109 1:143975906-143975928 ATTTTTCAGGAGAGGGAAATGGG - Intergenic
914156336 1:145092060-145092082 ATTTTTCAGGAGAGGGAAATGGG + Intronic
914795951 1:150920578-150920600 ATATTTTACTAGACAGAAAAAGG + Intergenic
915452160 1:156013549-156013571 ATAATGGAGTGGAGGGAAAAGGG + Intronic
915868895 1:159536645-159536667 CAATTTTAGTAGAGAGATAATGG - Intergenic
916379345 1:164191411-164191433 ATATTATAGTCTAGGGTAAAAGG - Intergenic
916494956 1:165338400-165338422 ATAATTGAGTTGAGGGAAAGGGG + Intronic
916987004 1:170202370-170202392 ATGTTAAAGTAGAGAGAAAAGGG - Intergenic
917294914 1:173508558-173508580 AAATTTTAGCAGAGGGATAAGGG - Intronic
918366106 1:183809528-183809550 ATGTTATTGTAAAGGGAAAATGG - Intronic
918788344 1:188793770-188793792 ATATCTTAATAAAGGGAGAAAGG + Intergenic
919073410 1:192784414-192784436 ATTTTATAGTTGAGGGAACATGG + Intergenic
919176270 1:194022445-194022467 ACATTTTAGTAGAGGAATTATGG - Intergenic
919255896 1:195124588-195124610 ATATTTTAGTAAAAGAGAAAGGG + Intergenic
919301616 1:195775710-195775732 ATATTTTGCAAGAGTGAAAATGG - Intergenic
919319898 1:196022381-196022403 ATATTTCAGAAGTAGGAAAAGGG + Intergenic
920022177 1:202964856-202964878 ATAATATAGTTGAGGGACAATGG + Intronic
920198753 1:204246418-204246440 ACATTTTAGTAGGGGGGATAGGG - Intronic
920468594 1:206206791-206206813 ATTTTTCAGGAGAGGGAAATGGG - Intronic
920593954 1:207250008-207250030 ATTTTATAGGAGGGGGAAAAAGG + Intergenic
920874946 1:209826134-209826156 ATATGTTGGGAGGGGGAAAAAGG + Intergenic
921837070 1:219789217-219789239 CTATTTTGATAGAAGGAAAATGG + Intronic
923449798 1:234105914-234105936 ATATTGTAGTTGAGGGAAAAGGG - Intronic
924723141 1:246642498-246642520 ATATGTTAGTAAACAGAAAAGGG - Intronic
1063301497 10:4853310-4853332 ATAAATTAGTAGTTGGAAAAAGG + Intergenic
1063761242 10:9080078-9080100 ATATTTGAGTACAGTGAATATGG - Intergenic
1064495596 10:15906599-15906621 ATATATTAATAGATGGAAATGGG - Intergenic
1065232585 10:23613517-23613539 AGGATTTAGAAGAGGGAAAAAGG + Intergenic
1067800413 10:49354517-49354539 ATATTTTAGTGGAATAAAAAAGG - Intergenic
1068038248 10:51788527-51788549 ATAATTTACTAAAGAGAAAATGG + Intronic
1068333142 10:55598994-55599016 ATACTTTTGTCGAGGGTAAATGG - Intronic
1068428774 10:56904938-56904960 ATATGTTAGTAGAGTCAGAAAGG + Intergenic
1069038987 10:63674797-63674819 ATATTTCTGTATAGGGAAAAGGG - Intergenic
1069578753 10:69550422-69550444 ATTCTTTAGGAGAAGGAAAATGG + Intergenic
1070237340 10:74642603-74642625 ATATTTTATAAGAGGGAATATGG - Intronic
1070460245 10:76660020-76660042 ATATTGTATTAAAGGTAAAAAGG + Intergenic
1070550542 10:77487730-77487752 ATATTTTAATAAAAGTAAAATGG + Intronic
1070752404 10:78972145-78972167 ATTTTAAAGTAGAGGAAAAAGGG + Intergenic
1071295881 10:84219309-84219331 AAATTTAGGGAGAGGGAAAATGG - Intronic
1071900001 10:90109987-90110009 ATATAATAGAAAAGGGAAAAAGG + Intergenic
1071933705 10:90502292-90502314 ATATTCTACTAGAGGAAAGAAGG - Intergenic
1072833303 10:98682793-98682815 ATATTTTTAAAGAGTGAAAAGGG + Intronic
1073500349 10:103931531-103931553 AGGATTGAGTAGAGGGAAAATGG + Intergenic
1073615468 10:104990618-104990640 ATATGTTACTCTAGGGAAAAAGG + Intronic
1074168877 10:110912849-110912871 ATACATTAATAGAGGGAAAAAGG - Intronic
1074661331 10:115661135-115661157 ATATTTTAGTTTTAGGAAAAAGG + Intronic
1076414241 10:130273853-130273875 ATATTTTAGTTGACAGGAAAAGG + Intergenic
1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG + Intronic
1077753736 11:5003117-5003139 ATGCTTTAGAAGAGGAAAAAAGG + Intergenic
1078612440 11:12832620-12832642 AAATTTTAATAGAGTGCAAAAGG - Intronic
1078898500 11:15619741-15619763 AGATTCTAATTGAGGGAAAATGG + Intergenic
1078968164 11:16371491-16371513 ACGTTCTAGTAGAGGGAAACAGG - Intronic
1079878576 11:25893076-25893098 AAATTTTATTAGAGAGAAAATGG + Intergenic
1080353284 11:31410915-31410937 ATATATCAGTTTAGGGAAAATGG - Intronic
1082170388 11:48997371-48997393 ATATTTAGGAATAGGGAAAAAGG + Intergenic
1082853044 11:57782352-57782374 TTATTTTAAAAGAGGGTAAAAGG - Intronic
1083752999 11:64772253-64772275 ACATATTATTAAAGGGAAAAAGG + Intronic
1084395882 11:68909802-68909824 ATTTTTTAGTAGAGACAACATGG + Intronic
1084585105 11:70055424-70055446 AAATTTTACTAGAGATAAAAAGG - Intergenic
1086190246 11:84070531-84070553 AGATTTGAGTAGAGGAAAATAGG - Intronic
1086204399 11:84240514-84240536 TTATTTTAGTAGAAAGAGAATGG - Intronic
1086270782 11:85063975-85063997 ATAATTTAGTTGAGAAAAAAGGG + Intronic
1086371025 11:86156057-86156079 ATATTTTAGATGATGGAATATGG + Intergenic
1086642096 11:89171744-89171766 ATATCTTAGGAGATGGAGAATGG - Intergenic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1087468132 11:98536625-98536647 ATTTTTTAGTAAAGAGAACAAGG - Intergenic
1087564587 11:99837919-99837941 ATATTTTATTAGAGGGACTTAGG + Intronic
1087961637 11:104357820-104357842 AGATTATAGAAGAGGAAAAATGG - Intergenic
1088207557 11:107411857-107411879 ATATTTAAAGAGAGGGACAAAGG + Intronic
1088296617 11:108304289-108304311 ATATGATAGAAGAGGGAAAAAGG - Intronic
1089135149 11:116243006-116243028 ATACTTTATTAGAGGGACAATGG + Intergenic
1089321725 11:117631046-117631068 ATATTTTATAGGAGGGAGAATGG + Intronic
1089480152 11:118798008-118798030 TTATTTTAGTAGTTGGCAAATGG + Intergenic
1089716432 11:120364529-120364551 TTATTTTAGTAGGGGCAAAGAGG + Intronic
1090821066 11:130342261-130342283 ACATTTTACTGGAGGGAAAATGG + Intergenic
1091096859 11:132831532-132831554 ATGTCTAAGTAGAGGGAAAATGG - Intronic
1091959549 12:4680998-4681020 ACATTTCAGTATAGGGAAAGAGG + Intronic
1092589331 12:9936175-9936197 ATTTTTTAGTAGAGGGTAAGGGG + Intergenic
1092816887 12:12320160-12320182 AAATTTTAGTAGAGGACATATGG + Intergenic
1092941168 12:13408501-13408523 ATTTTTTAATAGGGGGATAAAGG - Intergenic
1093427807 12:19048585-19048607 ATATTTTAAAAGAGGGAGAGAGG + Intergenic
1093820233 12:23607523-23607545 ATATTTTAATGGAGAGAAAAAGG - Intronic
1094015717 12:25861092-25861114 ATTTTTTAGTAAAGTGATAAGGG - Intergenic
1094341251 12:29413957-29413979 ATATGTTGGCAGAGGGAAAACGG - Intronic
1095338882 12:41064827-41064849 ATTTTATAGTTGAAGGAAAAAGG + Intronic
1095378508 12:41560162-41560184 ATATTTTAGTATGGAGACAAAGG - Intronic
1095477100 12:42596758-42596780 ATCTTTGAGCAGAGGGGAAATGG - Intergenic
1095672642 12:44877662-44877684 ATATTATACTATAGGGAAAGAGG + Intronic
1095850778 12:46801954-46801976 ATATCTGAGTAGAGGAAAAAAGG - Intronic
1096050206 12:48600812-48600834 AGAATTTAGGAGAGGGAGAAGGG - Intergenic
1096208912 12:49747136-49747158 ATAGTTTAAAAGAGGGGAAAGGG - Intronic
1096669618 12:53190831-53190853 ATATTTAAATAAAAGGAAAATGG + Exonic
1096889449 12:54752997-54753019 CTATATTAGTAGTGGGAGAAGGG + Intergenic
1098198433 12:68027594-68027616 ATATTTTAGTGGAGTGAGACTGG + Intergenic
1098230069 12:68364123-68364145 ACATTTTGGTAGAGGGAAGCAGG - Intergenic
1098244592 12:68503220-68503242 ATATTGGAGTAGTGGGAAAAGGG - Intergenic
1098789544 12:74804246-74804268 ATATTTGAGGATAGGGAGAAAGG - Intergenic
1099914192 12:88871748-88871770 TTATTTTTGGAAAGGGAAAATGG - Intergenic
1100042264 12:90334501-90334523 CCATTTTAGTAGATTGAAAATGG - Intergenic
1100053745 12:90483881-90483903 ATTCTTTAGGAAAGGGAAAAGGG - Intergenic
1101516180 12:105437779-105437801 TTATTTTAGCAGTGTGAAAATGG - Intergenic
1101658643 12:106746891-106746913 AAATTTTAGAAGGGAGAAAAGGG - Intronic
1102028336 12:109726200-109726222 CTATTCTAGGAGAGGGAACAGGG - Intronic
1102333973 12:112061518-112061540 CTATTTTGGTAGATAGAAAATGG - Intronic
1102960477 12:117089944-117089966 AAATTTTAAAACAGGGAAAAGGG + Intronic
1103229528 12:119317243-119317265 ATATTTTTGTATAGTGAAATAGG - Intergenic
1103502761 12:121416502-121416524 GTATTTTTCTAGATGGAAAATGG - Intronic
1104506076 12:129333805-129333827 ATATTTTATAAGTGGGAAAGGGG - Intronic
1105680921 13:22726391-22726413 ATATCTTAGTAGAGTGAACGTGG - Intergenic
1105892861 13:24694551-24694573 ATTTATTAGTAGAGTTAAAAGGG - Exonic
1106066827 13:26360825-26360847 AAATCATAGTAGAGGTAAAAGGG - Intronic
1106084945 13:26533415-26533437 ATTTCTTAATAGAAGGAAAATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106869043 13:33998994-33999016 GCATTTTGGTAGAGGGAGAAGGG + Intergenic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107007945 13:35636036-35636058 ATATTTTACTCAAGGGAAGAAGG + Intronic
1107195242 13:37643419-37643441 ATATTTGAGTACAGGGGAGAAGG + Intronic
1107569847 13:41645231-41645253 TTATTTTAGGAGAGTGAAAAAGG + Intronic
1107732346 13:43360904-43360926 ATGTTTTGCTAGATGGAAAATGG - Intronic
1108160032 13:47629487-47629509 ATATTTTTGCAGTGGGACAAGGG - Intergenic
1108225854 13:48287977-48287999 CTATTTCAGAAGAGGGGAAAAGG + Intergenic
1108438942 13:50429194-50429216 AAATATTATTAAAGGGAAAAAGG - Intronic
1109235790 13:59817861-59817883 TTATTTTAGTCAAGGGAGAAAGG - Intronic
1109751679 13:66701004-66701026 ATATATAAGTAGGGAGAAAAAGG - Intronic
1110051027 13:70899691-70899713 TTATTTAAATAGAGTGAAAAAGG + Intergenic
1110462724 13:75763412-75763434 ATATTTTAGTAGAGTGTCAAAGG - Intronic
1110581288 13:77131624-77131646 ATATTTTAATAGTGAGAAATTGG - Intronic
1111026530 13:82535243-82535265 ATATTTTAGAAAAATGAAAATGG + Intergenic
1111265037 13:85799161-85799183 GAATTTTAATTGAGGGAAAAAGG - Exonic
1111720487 13:91937637-91937659 ATACATTAGGAGAGAGAAAATGG + Intronic
1112270070 13:97960316-97960338 ATATTTGTGGAGAGGGAGAATGG - Intronic
1113519689 13:110931021-110931043 ATAATTTAATAGAAGGAAAAAGG + Intergenic
1114330836 14:21635272-21635294 AGATTTTAGCTGAGGAAAAAGGG - Intergenic
1115173826 14:30538994-30539016 AAATTTTTGTAGATGGAACAAGG - Intergenic
1115178366 14:30592041-30592063 ATATTTTAGTAGGAAGGAAAAGG + Intronic
1115346218 14:32345847-32345869 ATATTGTATAAGAGGGAGAAAGG + Intronic
1116017071 14:39420337-39420359 ATACTTTAGTAAAGGTAAAATGG + Intronic
1116696278 14:48182414-48182436 TTATTTTAGCAGTGTGAAAATGG + Intergenic
1116745503 14:48813479-48813501 ATATTTAATTAGAGGCCAAAAGG + Intergenic
1117018111 14:51539705-51539727 AAACTTTAGTAGAGAGAGAAAGG - Intronic
1117827227 14:59716426-59716448 ATGTTTTGGTAGAGGCCAAATGG + Intronic
1117945699 14:61017437-61017459 ATATGTTACTTGAGGGTAAAAGG + Intronic
1118038558 14:61893689-61893711 AGATTCTAGTGGATGGAAAATGG - Intergenic
1118091276 14:62482414-62482436 ATATTTTATAAGAGTGATAATGG + Intergenic
1118115688 14:62774099-62774121 AAAATTTAGCAAAGGGAAAAGGG + Intronic
1118534873 14:66750618-66750640 ATTTTTTGGTAGCAGGAAAAAGG + Intronic
1119058756 14:71451871-71451893 ATATTTGAGAGAAGGGAAAATGG + Intronic
1119166887 14:72502063-72502085 ATAGTTTGAGAGAGGGAAAAAGG - Intronic
1120437240 14:84496259-84496281 ATATTTTTGTAGAGACAACAGGG + Intergenic
1121550719 14:94797638-94797660 ATCTTTTAGTTAAGTGAAAATGG - Intergenic
1121697426 14:95925174-95925196 ACATTGTAGAAGAAGGAAAAAGG + Intergenic
1122584370 14:102794568-102794590 ATATTTGAGGAGAGGGGACATGG + Intronic
1123926044 15:25112030-25112052 AAATTCTAGGAGAGGAAAAAAGG - Intergenic
1124094602 15:26637415-26637437 ATGTTCTAGCAGGGGGAAAAAGG - Intronic
1125143555 15:36439195-36439217 ACTTTATAGTAGAGGAAAAAAGG - Intergenic
1125335668 15:38623860-38623882 AGATTTGAGGAGAGGAAAAATGG - Intergenic
1125382289 15:39099643-39099665 ATGTGTTAGGAGAGGGAAAGTGG - Intergenic
1127548040 15:60007636-60007658 GTATTTGTGTATAGGGAAAAAGG + Intronic
1129806258 15:78461381-78461403 AAATGATAGAAGAGGGAAAAGGG - Intronic
1130228086 15:82075270-82075292 ATATTTTATAAGAGTGAAAAAGG - Intergenic
1131900065 15:97078117-97078139 GTGTTCTAGTAGATGGAAAAAGG + Intergenic
1132903564 16:2271124-2271146 AGGTTTTAGTAGTGGGTAAAAGG - Intergenic
1133313063 16:4863620-4863642 ATCTTATAATAGAGGGAAAAGGG - Intronic
1133753800 16:8746123-8746145 GTATTTTGGAAAAGGGAAAAAGG + Intronic
1134757170 16:16677921-16677943 AAATTTTAGCAAAGGGAACATGG - Intergenic
1134988898 16:18681242-18681264 AAATTTTAGCAAAGGGAACATGG + Intergenic
1135555890 16:23436372-23436394 TCATTTTAGGAGATGGAAAAGGG + Intronic
1135556455 16:23440985-23441007 ATATATATGGAGAGGGAAAAAGG + Intronic
1135603036 16:23799581-23799603 CAATTTTAGTAGAGAGAAACTGG - Intergenic
1135751311 16:25060685-25060707 TTGTTTTGGTAGAGGGAGAAAGG + Intergenic
1135817464 16:25648454-25648476 ACATTAGAGCAGAGGGAAAAGGG + Intergenic
1135831993 16:25782678-25782700 ATATTTTATTAAAGAGAAATGGG - Intronic
1137804247 16:51288517-51288539 TTATTTTATAAGTGGGAAAATGG + Intergenic
1138136421 16:54527246-54527268 ATATTTTAAGAGAGCAAAAATGG + Intergenic
1139486817 16:67262418-67262440 ATAGTTTAATAGAGAGATAAGGG + Intronic
1140015879 16:71184001-71184023 AAATTTGAGTGGAGGGAACATGG - Intronic
1140163243 16:72521670-72521692 ATAATTTAGTGAAGGGAAATGGG + Intergenic
1140276927 16:73517703-73517725 AGTTATTGGTAGAGGGAAAAAGG + Intergenic
1140498103 16:75407717-75407739 ATTTTTTAGTGAAAGGAAAAAGG - Intronic
1141325339 16:83052009-83052031 ATATTGTAAGAGAAGGAAAATGG + Intronic
1141936361 16:87241409-87241431 AGATTTTCCTAGAGGGACAAGGG + Intronic
1144290649 17:13823028-13823050 AAATATTTGTAGAGGAAAAAGGG + Intergenic
1147433351 17:40388468-40388490 ATATTTTAGAATAAGGAAAAGGG + Intergenic
1148549635 17:48542903-48542925 ATATTTTAGAAGAAGAAGAAAGG + Exonic
1149466125 17:56880558-56880580 ACATTTTAGTCTAGGGAAAAGGG - Intergenic
1149536674 17:57438673-57438695 GTATTTTAGGAGGGGGAAAATGG + Intronic
1150265234 17:63827945-63827967 TTATTTTAGTCCTGGGAAAATGG + Intronic
1151065891 17:71149247-71149269 GTGTTTTAGTACAGAGAAAAAGG - Intergenic
1151531775 17:74711122-74711144 ATTATTTAGAAGAGGGAAACAGG + Intronic
1151911171 17:77084228-77084250 TTATTTTAGTAGAGACAAGAAGG - Intergenic
1152239341 17:79153371-79153393 ATTTTCTAGTAGAGGGAATTTGG - Intronic
1153195280 18:2588927-2588949 ACATTTTAGTAGACAGAAAGAGG + Intronic
1153538308 18:6127582-6127604 CTATTTTAGTAGAGAGAGAAAGG - Intronic
1153716840 18:7858769-7858791 ATTATTTAGTAGATGGAACAAGG - Intronic
1154093170 18:11383952-11383974 ATATCTTAGGATAGGTAAAAGGG + Intergenic
1156102008 18:33607490-33607512 TTATTTTATTAGAGGGGAAGGGG - Intronic
1156209907 18:34928408-34928430 GGATTTTACCAGAGGGAAAATGG - Intergenic
1157108175 18:44794183-44794205 CTATTTTAGAAGAGCTAAAAGGG - Intronic
1158268522 18:55686840-55686862 ATATATTAGTAGACAGTAAATGG - Intergenic
1158870542 18:61683243-61683265 ATATTTTACAAGTGGAAAAATGG - Intergenic
1159091394 18:63853117-63853139 CTATTTTAGTAAAGGGAATGTGG - Intergenic
1160071714 18:75634951-75634973 GTAATTTAGTGGGGGGAAAAAGG - Intergenic
1163340974 19:16706844-16706866 ATATTTGAGTAAGGGGAAAAAGG - Intergenic
1163539548 19:17899365-17899387 GTATTTTAGTAGAGAGTAGAGGG + Intergenic
1166400940 19:42479493-42479515 ATATTAAAGTAGAGGGATAAGGG - Intergenic
925494955 2:4436379-4436401 TTCTTTTAGCAGTGGGAAAATGG - Intergenic
925610058 2:5695015-5695037 GTATTTTTGTACAGTGAAAAGGG + Exonic
926997147 2:18748265-18748287 ATATAGTAATGGAGGGAAAAAGG - Intergenic
927359866 2:22220580-22220602 ATATTTTAGTACTGGGAAATGGG + Intergenic
927391068 2:22596155-22596177 TTATTTCAGTAGAGGGTATAGGG + Intergenic
928241423 2:29590250-29590272 ATATTTTAATTGATTGAAAACGG + Intronic
928532937 2:32210761-32210783 ATGCTTTTGTAGTGGGAAAATGG + Intronic
928600433 2:32899017-32899039 ATGTGTTGGTAGAGGGACAAAGG - Intergenic
928624695 2:33127784-33127806 GTATTTTAGTTGAGTCAAAAGGG + Intronic
929321325 2:40546420-40546442 ATATTCTAGTATAAGGAGAAAGG + Intronic
929851585 2:45596060-45596082 ATATTTTCTAAGAGGGCAAAAGG + Intronic
929972892 2:46598988-46599010 ATATTTCTTTCGAGGGAAAATGG - Intronic
930324816 2:49902048-49902070 ATATTTTAGAAAAGGGAAGGAGG + Intergenic
930726075 2:54682713-54682735 ATATTTTAATATAGGAAAACAGG - Intergenic
930747861 2:54903283-54903305 GTATTTTAAAAGTGGGAAAATGG - Intronic
931840996 2:66148067-66148089 ATATTTTCCTAGAGGGACAAGGG - Intergenic
933002678 2:76945389-76945411 TTATTTTAGCAGATTGAAAATGG + Intronic
933205675 2:79504784-79504806 AAATTTAAGTACAGTGAAAAGGG + Intronic
933349087 2:81129819-81129841 ATATTATAGTAAAAGAAAAAAGG - Intergenic
933441508 2:82320532-82320554 ATATTATATTACATGGAAAATGG - Intergenic
933555746 2:83827919-83827941 ATATTTTATTAGGGGGATCAGGG + Intergenic
934164975 2:89285820-89285842 ATCTTTTAGTGGAGGGGTAAAGG - Intergenic
934166579 2:89299496-89299518 TTGCTTTTGTAGAGGGAAAAGGG + Intergenic
934200698 2:89882960-89882982 TTGCTTTTGTAGAGGGAAAAGGG - Intergenic
934202299 2:89896646-89896668 ATCTTTTAGTGGAGGGGTAAAGG + Intergenic
935420206 2:102859765-102859787 ATATTTTAGTATCTGGAAATGGG - Intergenic
935443306 2:103128378-103128400 TCATTTTATTAGAGGAAAAAAGG - Intergenic
935530468 2:104226719-104226741 ATTTGTTAGAAGAGGAAAAAAGG + Intergenic
936825209 2:116574204-116574226 ATATTCTACTACAGGGCAAAAGG + Intergenic
937702090 2:124874550-124874572 ATATTTTAGAAGAGTAAAGAAGG - Intronic
937779801 2:125823893-125823915 ATATTTTAGAGAAAGGAAAATGG + Intergenic
937803533 2:126109376-126109398 ATATTTTAGTGGTGAGATAATGG + Intergenic
937805799 2:126143600-126143622 ATATTTTAATAGAGAGGAAAGGG - Intergenic
939046846 2:137259742-137259764 TCATTCTAGTAGAGGGAGAAAGG - Intronic
939521220 2:143233014-143233036 ACATCTTAGTAGAAGGTAAAGGG - Intronic
939669486 2:144992806-144992828 ATAAGTTAAGAGAGGGAAAAGGG - Intergenic
939836520 2:147136030-147136052 ATATATTAGAGAAGGGAAAACGG - Intergenic
940574850 2:155489749-155489771 ACATTCTAGTAGGGGAAAAAGGG + Intergenic
941371001 2:164663981-164664003 ACATTTTAGTAAAAGCAAAAAGG - Intronic
942037896 2:172028946-172028968 ATATTTTAGAAGACTAAAAATGG - Intronic
943218131 2:185065703-185065725 ATAATTTAGTAGAGTGGGAAAGG + Intergenic
944629432 2:201608385-201608407 AAATTTTGGTAGAGGGGAAGGGG + Intronic
944774922 2:202953526-202953548 AGATTCAAATAGAGGGAAAAGGG - Intronic
944997091 2:205305789-205305811 ATATTTTATTAGATGTAACATGG + Intronic
945338950 2:208628376-208628398 GTATTTTTGTATAGGGAACAAGG - Intronic
947004809 2:225498840-225498862 AAGTTTCATTAGAGGGAAAAGGG + Intronic
947512872 2:230774693-230774715 ATATTTTAAGAGGGGGGAAAGGG + Intronic
948152003 2:235751879-235751901 ATACGTTAGTGGAGGGAAGAAGG - Intronic
948552830 2:238785950-238785972 ATATTTTACCACAGTGAAAAAGG + Intergenic
1169923780 20:10761753-10761775 TCATTTTAGAATAGGGAAAATGG - Intergenic
1169971020 20:11269665-11269687 ATATTGTATTAGAGTTAAAACGG - Intergenic
1169997747 20:11577447-11577469 TGATTTTAATAGATGGAAAAGGG - Intergenic
1170167098 20:13371897-13371919 ATATATTACTAGAGATAAAAAGG - Intergenic
1170343162 20:15351951-15351973 ACATTTTAGTGCAGTGAAAATGG + Intronic
1170368716 20:15625058-15625080 ATATTTAAACAGAAGGAAAAGGG - Intronic
1170379605 20:15742680-15742702 TTATTTTAGTTGAGGTCAAAAGG - Intronic
1170497885 20:16944472-16944494 ACATTTTAGCACAGGGAAACAGG - Intergenic
1173404555 20:42753407-42753429 ATATTTAAATGGAGGAAAAATGG + Intronic
1174549097 20:51348714-51348736 GTATTTTAGTAGAGACAACAGGG - Intergenic
1176291699 21:5049047-5049069 GTATTTTAGTAGAGGAGACAGGG - Intergenic
1176977735 21:15342135-15342157 ATATTTTAGTAGGGGTATAATGG - Intergenic
1177336888 21:19740286-19740308 ATATATTACCAGAGGGATAATGG - Intergenic
1177658795 21:24055664-24055686 AGGTTTCAGTGGAGGGAAAATGG - Intergenic
1177931453 21:27289373-27289395 ATATATTTTAAGAGGGAAAAAGG + Intergenic
1179865556 21:44214594-44214616 GTATTTTAGTAGAGGAGACAGGG + Intergenic
1181146636 22:20853151-20853173 ACATTTTAGGACATGGAAAAAGG + Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1182387922 22:29962497-29962519 TTATTTTTGTGGGGGGAAAAGGG - Intronic
1182983362 22:34693998-34694020 ATCTTTTAGTTAAGGGAAAGAGG - Intergenic
949276140 3:2284049-2284071 GCATGTTAGCAGAGGGAAAAAGG + Intronic
949614526 3:5739005-5739027 ATTTTTTAGTAAAGGGATAAGGG + Intergenic
949668859 3:6375039-6375061 ATATTTTGGTTGAGGTCAAATGG + Intergenic
950981150 3:17305749-17305771 ATATGATAGGAGAGGGAGAATGG - Intronic
951243130 3:20310113-20310135 ATATTTGAGTGGAGAGAAAGAGG - Intergenic
951688032 3:25366312-25366334 ATATTCTAGTAGGGGGAACATGG - Intronic
952800081 3:37282285-37282307 AAATTTTTGTACAGGCAAAAAGG - Intronic
953603642 3:44391934-44391956 ATATTATAATAGAGCTAAAAAGG - Intronic
953808580 3:46092960-46092982 ATATTTTAATAGAGGGACCCAGG + Intergenic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
955802860 3:62704121-62704143 ACATTCTAGTAGGGGGAAAAAGG + Intronic
955955438 3:64284587-64284609 TTATTTAAGAAGAAGGAAAATGG - Intronic
956112572 3:65884520-65884542 GTATTTTAGTAGTTAGAAAATGG - Intronic
956189585 3:66596026-66596048 TTACTTTAGAGGAGGGAAAATGG + Intergenic
956257627 3:67301285-67301307 AGATTTTAGTGGAAGAAAAAAGG - Intergenic
956558547 3:70548359-70548381 AATTTAGAGTAGAGGGAAAAGGG + Intergenic
956651439 3:71508154-71508176 ATATTTCTATAGGGGGAAAAAGG + Intronic
957439856 3:80230883-80230905 ATATTTTAGGACAGGGTAATTGG + Intergenic
957469100 3:80635511-80635533 ATAATTAAGTATAGTGAAAAAGG - Intergenic
958068376 3:88575702-88575724 ATATTTTAGTACAGGGAGACAGG + Intergenic
958587952 3:96115880-96115902 AAATTTTAGTGGAGGGAATGAGG + Intergenic
958661573 3:97075108-97075130 ATTAGTTAGTAGAGGAAAAAAGG + Intronic
958748779 3:98169645-98169667 CTATTTTAGTAAATAGAAAAAGG - Intronic
959330053 3:104993391-104993413 ATATTTTAGTTGACATAAAAGGG + Intergenic
959418554 3:106105809-106105831 ATATCTAAGGAGAAGGAAAAGGG - Intergenic
960140750 3:114149748-114149770 ATTTTTTAGGAGATGGCAAAAGG + Intronic
960166271 3:114405313-114405335 ACATTTTAGTAGAGAGAACATGG + Intronic
960360964 3:116710551-116710573 AAATTTTAGTAGAGAAATAAGGG - Intronic
960366474 3:116778871-116778893 ATATTTTTGTAGAGCTATAAGGG + Intronic
960391485 3:117082543-117082565 ATATTTGAGAAGAGAGGAAATGG - Intronic
960474341 3:118105851-118105873 ATATTTTAATAAATAGAAAATGG - Intergenic
961026105 3:123559332-123559354 AAATTTATCTAGAGGGAAAAAGG + Intronic
962726321 3:138231421-138231443 ATACTTTGGGGGAGGGAAAAAGG + Intronic
963364883 3:144322563-144322585 ATATATTAGTAGGATGAAAATGG + Intergenic
963569743 3:146978472-146978494 ATATTTTAGGAGAGAAAACACGG + Intergenic
963654330 3:148025818-148025840 ATTTTTTAGGACAGGAAAAATGG - Intergenic
963690633 3:148496963-148496985 ACATTTTATTAGAGGACAAAGGG - Intergenic
964790281 3:160448109-160448131 ATTTTTTAGTTTAGGGAAACAGG - Intronic
964935293 3:162076966-162076988 ATATTTTAATAGAAGAAAAGTGG + Intergenic
965422354 3:168477232-168477254 ATATTTAATTACATGGAAAATGG + Intergenic
965877990 3:173351473-173351495 ATATTTTTATGGAGGGATAAAGG + Intergenic
968339065 3:197939654-197939676 TTATTTTACCAGTGGGAAAATGG - Intronic
971661830 4:29428086-29428108 AGATTTTATTGGAGGGAAACTGG + Intergenic
971896345 4:32601306-32601328 ATAGTTTAGTATAAGGAACAGGG - Intergenic
972000385 4:34024559-34024581 ATATTATAGGAGTTGGAAAACGG + Intergenic
972627180 4:40811234-40811256 ATACTTTGGTAGAGTGAAAAGGG + Intronic
972852336 4:43066438-43066460 ATATTTTAATAGACTTAAAAAGG + Intergenic
972947866 4:44280107-44280129 AATTTATAGTAGAGAGAAAATGG + Intronic
972994408 4:44862793-44862815 TTATTTTAGCTTAGGGAAAATGG + Intergenic
974064401 4:57064401-57064423 ATATTTTTATATTGGGAAAATGG + Intronic
974826280 4:67134746-67134768 TTGTTGTAGTACAGGGAAAAAGG - Intergenic
974970682 4:68822748-68822770 ATATTTCAGTTAAGTGAAAATGG + Intronic
974985109 4:69013655-69013677 ATATTTCAGTTAAGTGAAAATGG - Intronic
974991927 4:69103530-69103552 ATATTTCAGTTAAGTGAAAATGG + Intronic
975101200 4:70515046-70515068 ATAATGTGGTAGAGGCAAAATGG - Intergenic
977147854 4:93468329-93468351 ATCTTCTAGTAGAGGGAGACTGG + Intronic
977180586 4:93868551-93868573 CTATTTTACTAGATAGAAAAAGG + Intergenic
978484333 4:109233856-109233878 ATTGTTGAGTAGATGGAAAAGGG - Intronic
978866447 4:113518258-113518280 ATATTATGGGAGAGGAAAAAGGG + Intronic
978913323 4:114092556-114092578 ATATATTTGTAGAGAGAAATTGG - Intergenic
980047582 4:128005771-128005793 AGATTTTAGAAGCGGGAAATGGG + Intronic
980726485 4:136768153-136768175 TTATGTTAGTAGAAGGAGAAAGG + Intergenic
981114831 4:140977249-140977271 TCATTATAGTAGAGGGAAATTGG - Intronic
981352554 4:143749776-143749798 ATATTTTAGTTCAGTAAAAATGG + Intergenic
981450544 4:144892109-144892131 TTATATTAGTAAAGTGAAAAGGG - Intergenic
982067577 4:151668032-151668054 ATATTTTAAAAGAGGGAATTTGG + Intergenic
982785009 4:159526448-159526470 ATATTTTACAAGTGAGAAAATGG + Intergenic
982924645 4:161320389-161320411 ATATTCTTGTCAAGGGAAAAGGG + Intergenic
983123761 4:163922469-163922491 ATATTTTGGTAGAGTGCAACAGG - Intronic
983305900 4:165986300-165986322 ATATTTTAGTACACAGAAATAGG + Intronic
983719801 4:170836306-170836328 ATATTTTGATTGAGGGAAAATGG - Intergenic
983726700 4:170937826-170937848 ATAATTTAGAAGAGGAATAAAGG + Intergenic
984129299 4:175853384-175853406 AGATTTTAGTTAAGGTAAAAAGG - Intronic
984184128 4:176521570-176521592 ATACCTTCCTAGAGGGAAAAGGG + Intergenic
984861909 4:184247845-184247867 ATATTGTAGGAGAGCAAAAATGG - Intergenic
985189043 4:187351744-187351766 ATATCTTAGTAGGGAGAAACAGG + Intergenic
987596262 5:20003552-20003574 ATTTGTTAGTAGAGGAGAAAAGG - Intronic
987778646 5:22402558-22402580 ATATTTTACTATAAGGAACAAGG - Intronic
988463738 5:31467200-31467222 ATATATTAGAAGAGGCTAAAGGG - Intronic
988668503 5:33356353-33356375 ATAATTTACTTGAGGAAAAAAGG + Intergenic
988886710 5:35565683-35565705 AGATTTTACAACAGGGAAAAGGG + Intergenic
988890535 5:35611822-35611844 TTATTTTGGTTGAGGCAAAACGG - Intergenic
989814862 5:45723510-45723532 ATTTTCTAGTAGAGGGAGTATGG + Intergenic
990495456 5:56343268-56343290 ATATTTCAGAAGAGGCAAAAGGG + Intergenic
990755597 5:59066061-59066083 TTCTTTTAGTAGAAGGAATAAGG - Intronic
991003441 5:61805453-61805475 AAATTCTAGTGCAGGGAAAATGG - Intergenic
991278292 5:64878678-64878700 AGATTTTAGTAGACAGAAATAGG + Intronic
992103535 5:73430843-73430865 ATGCTTTGGTAGAGGGTAAAGGG + Intergenic
992820283 5:80488911-80488933 GTATATTAGTATAGGGAAATAGG + Intronic
993080775 5:83296615-83296637 ATATTTTATTAGATGGAAGGAGG + Intronic
995367213 5:111376098-111376120 ATATTAAAGTAGGGAGAAAAGGG + Intronic
996317964 5:122182645-122182667 ACACTTCAGTAGAGAGAAAAGGG - Intergenic
996656576 5:125944785-125944807 ATATTGTAATAGAGGCAGAAGGG - Intergenic
996813938 5:127552977-127552999 ATATATTATTTGAGGGGAAAAGG - Intronic
996973384 5:129399898-129399920 ATTTTTAAATAGAGGCAAAAAGG + Intergenic
997093642 5:130885904-130885926 ATATTTGAGCTGAGGGAAACAGG + Intergenic
998384911 5:141751520-141751542 ATAATTTACTAGAAGGAAGATGG + Intergenic
999509295 5:152231319-152231341 ATATTTTGAGAGAGAGAAAAAGG + Intergenic
999874408 5:155786551-155786573 ACATTTTACTAAAGGGAAAGAGG + Intergenic
1000424844 5:161078566-161078588 CCATTTTAGTTGAGGGTAAAAGG + Intergenic
1000824200 5:166023883-166023905 ATATTAAAGTAGAGAGAAACTGG + Intergenic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1001457801 5:171879062-171879084 ATATTTTAGAAAAGGAAGAAAGG + Intronic
1002986915 6:2199051-2199073 ATATTTTAGGATAGGAAAATGGG - Intronic
1003691056 6:8354133-8354155 ACATTTTAGGAGAGGGGAGAGGG + Intergenic
1003943061 6:11047194-11047216 ATATTTTATTAAATAGAAAAAGG + Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005136795 6:22578157-22578179 CCATTTTAGCAGATGGAAAAAGG + Intergenic
1005669242 6:28088195-28088217 ATACATTTCTAGAGGGAAAATGG - Intronic
1006690233 6:35877539-35877561 ATTTTTTAGAAGACTGAAAATGG + Intronic
1007434984 6:41804253-41804275 ATATTTTGGGAGAGGTGAAAAGG - Intronic
1008307625 6:49923681-49923703 ATATTTTAGGAAAGGGGCAATGG - Intergenic
1008794399 6:55284197-55284219 ATAATTTAAAAGAGAGAAAAGGG + Intergenic
1009046325 6:58240964-58240986 ACATCTAAGTAGGGGGAAAAGGG + Intergenic
1009292416 6:61900141-61900163 ATTATTTACTAGAGGTAAAATGG - Intronic
1009571908 6:65395805-65395827 ATATTTCAGTAGAGTTAGAAGGG - Intronic
1009915886 6:69995267-69995289 ATTTTGTGGTAGAGGGATAAAGG - Intronic
1010189206 6:73177199-73177221 AAAATTCAGTAGAAGGAAAAGGG + Intronic
1010401686 6:75453508-75453530 ATTTTTTAAGAGAGGGAGAAAGG + Intronic
1010953569 6:82065462-82065484 ATATTTTAGTAGAAGAACTAAGG + Intergenic
1011166624 6:84454870-84454892 ACATTTTAAAAGAGGGACAAAGG + Intergenic
1011807634 6:91090143-91090165 ATATTCCAGGAGAGAGAAAACGG - Intergenic
1011895944 6:92225277-92225299 ATATTTAAGTGGAAGAAAAATGG - Intergenic
1012856736 6:104510985-104511007 ATATTGGGGCAGAGGGAAAAAGG + Intergenic
1012871781 6:104681702-104681724 TAATTTTCTTAGAGGGAAAAAGG - Intergenic
1013276898 6:108594180-108594202 AATTTTAAGTAGAAGGAAAAGGG + Intronic
1014303036 6:119707405-119707427 AAATTTTAGGAGAGGGAATCTGG - Intergenic
1014450720 6:121578264-121578286 ATATTTAAGAAAAGGGAAGAAGG + Intergenic
1014465169 6:121748140-121748162 AAGTTTTAGTTGAGTGAAAAGGG + Intergenic
1015184497 6:130398914-130398936 AGACTTTAGTAGAAGGAAATTGG - Intronic
1015455179 6:133418832-133418854 ATATTTGAAAAGAGAGAAAACGG + Intronic
1015764950 6:136706497-136706519 ATCATTTAGAAAAGGGAAAAGGG + Intronic
1016109772 6:140208257-140208279 AAATTGTAGTAGAGTTAAAAAGG - Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016227389 6:141755652-141755674 AGGTTTTAGGAAAGGGAAAAAGG + Intergenic
1016368271 6:143342227-143342249 ATTTTCTTGTAGTGGGAAAATGG + Intergenic
1016632149 6:146245616-146245638 ATATGTTTGTGGTGGGAAAATGG - Intronic
1016959661 6:149660538-149660560 ATCTTTTAGGAAGGGGAAAAAGG - Exonic
1017606515 6:156140432-156140454 AAATAATATTAGAGGGAAAAAGG - Intergenic
1017687215 6:156925622-156925644 ATAGTTTATTAGAAGGAATATGG + Intronic
1017697256 6:157029517-157029539 ACATTTCAGTAAAGGGAGAAAGG + Intronic
1017757195 6:157539555-157539577 CTATTTAAGAAGAGGGAAAGAGG + Intronic
1017967538 6:159279564-159279586 AAAGTTTAGGAGAGGGAAGAGGG + Intergenic
1018728735 6:166633041-166633063 ATTTTTTAGTAGAGAAAACATGG - Intronic
1019872527 7:3778669-3778691 ATATTTTAGTTTACGGAACATGG - Intronic
1020928424 7:14361855-14361877 GTATTTTAATATAGGAAAAAAGG - Intronic
1021152903 7:17173843-17173865 TTATTTTAGTAGATAGGAAATGG + Intergenic
1021325714 7:19265010-19265032 ATATTTTAAAAAATGGAAAATGG + Intergenic
1024366281 7:48524176-48524198 ATAGTCTAGAAGAGGCAAAAAGG - Intronic
1024820010 7:53317610-53317632 AGATTTTAGTTGAGGCAGAATGG + Intergenic
1024895612 7:54258520-54258542 GCATTTTAGTTGAAGGAAAATGG + Intergenic
1025854491 7:65265556-65265578 AGATTTTATTAGAAGGAAGAGGG + Intergenic
1027540732 7:79461596-79461618 ATATTGTGATAGAGAGAAAAGGG - Intergenic
1027588640 7:80090140-80090162 ATCTTTTAACAGAGGCAAAAGGG - Intergenic
1028203555 7:87990962-87990984 TTATTTTAAAAGAGGGAGAAAGG - Intronic
1028214074 7:88110353-88110375 AGATTTTAAGAGAGAGAAAAGGG - Intronic
1029024085 7:97396275-97396297 ATAATTTAGCAAAGAGAAAATGG - Intergenic
1030540196 7:110820917-110820939 ACATTTTAGTGGAGGGAGATTGG - Intronic
1030694141 7:112566560-112566582 ATATTACAGAAGAGGGAAAGAGG - Intergenic
1031068370 7:117133791-117133813 ATATTTTAAAAGATGGAAAGAGG - Intronic
1032377532 7:131436763-131436785 ATATTGTAGTATAGTCAAAAGGG - Intronic
1033262584 7:139856523-139856545 ATATTTTGATGGAGGGGAAAAGG + Intronic
1033269503 7:139918112-139918134 ATGGCTTAGAAGAGGGAAAATGG - Intronic
1033271125 7:139934037-139934059 ATATTTTCCTGGAAGGAAAATGG - Intronic
1033296021 7:140136460-140136482 ATATTTTAGTAATGGTTAAAGGG + Intronic
1033298428 7:140162479-140162501 ATATTTTATTATGGGGAAGAGGG - Intronic
1033535685 7:142309818-142309840 ATATTTTGGTAGAGGAACACTGG + Intergenic
1033984063 7:147200983-147201005 ATATTTTAGAAGAGTGAAGATGG + Intronic
1033990800 7:147283939-147283961 GTATCTTAGTAAAGGGAAGATGG - Intronic
1036954589 8:13173680-13173702 TTAATTTAGTAGCGGAAAAAAGG - Intronic
1037030670 8:14100784-14100806 ATAATTTAATACAGGCAAAAGGG - Intronic
1037218009 8:16481706-16481728 AGATTTGAGTAGAGGCACAAAGG + Intronic
1038332840 8:26623171-26623193 ATATTTTAGGAGCTGAAAAACGG + Intronic
1038375607 8:27037318-27037340 AAGTTTTGGTAGAGGGACAAAGG + Intergenic
1038417367 8:27406929-27406951 ATATTTTAGTAGGGGGACTTTGG + Intronic
1038858149 8:31355756-31355778 ATATTTCAAAAGAGGTAAAAGGG - Intergenic
1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG + Intronic
1040988519 8:53323125-53323147 ATATCTTTGTAAAAGGAAAATGG - Intergenic
1041073163 8:54144814-54144836 ATAATAAACTAGAGGGAAAACGG - Intronic
1041564916 8:59265805-59265827 TTCTCTTATTAGAGGGAAAAAGG - Intergenic
1043160208 8:76837548-76837570 ACATTTTATTAAAGGGAAATAGG + Intronic
1043939373 8:86179593-86179615 ATTTTTTAGTAGAGAGAGACGGG + Intergenic
1044147310 8:88733060-88733082 ATATTGTAGTGGATAGAAAATGG + Intergenic
1044541467 8:93413128-93413150 ATATTTTACTAGAGATAAAATGG - Intergenic
1044569693 8:93702818-93702840 ATTTTTTAATAGCAGGAAAAGGG - Intronic
1045736538 8:105302449-105302471 ATATTAAAGTAGAGAAAAAAGGG + Intronic
1045865947 8:106865745-106865767 ATGTTTTAGAATAGTGAAAACGG + Intergenic
1046334540 8:112767834-112767856 ACATTCTAGCAGAGGGAAAGGGG - Intronic
1046701720 8:117408153-117408175 ATATATAAGTGGAAGGAAAAAGG + Intergenic
1049291591 8:141805873-141805895 ATTTTTCAGTGGAGGGGAAAGGG + Intergenic
1050263020 9:3860898-3860920 ATATTTTAGTAAGGGGAGACAGG + Intronic
1050507498 9:6363116-6363138 ATATTTTATTAGAGGGTGCAGGG + Intergenic
1051214236 9:14779166-14779188 ATATTTCTGGAGGGGGAAAATGG - Intronic
1051535438 9:18152301-18152323 AGATTTTAGTAGAAGGAGATAGG + Intergenic
1051928449 9:22356834-22356856 TTGTTTTAGTAAAGGGGAAAAGG + Intergenic
1052231286 9:26157299-26157321 ACGGTTTAGTAGAGTGAAAAAGG + Intergenic
1052578080 9:30316401-30316423 ATTAATTAGTAGAGGGAACATGG - Intergenic
1054834964 9:69667708-69667730 ATGGTGTAGTAGAGGGAAAGTGG - Intronic
1055280440 9:74668033-74668055 ATATTTTTGGACAGTGAAAAGGG + Intronic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1056474187 9:86937232-86937254 ATTCTTTAGTAGAGGAAGAATGG + Intergenic
1056607068 9:88094617-88094639 ATATTTTAAAAGAAGGAAATGGG + Intergenic
1056979712 9:91298199-91298221 ATATTTTGTTAAAGGTAAAAGGG - Intronic
1057737269 9:97675099-97675121 AGATTGGGGTAGAGGGAAAAGGG - Exonic
1057941205 9:99286390-99286412 AGGTTTTAGAATAGGGAAAAGGG - Intergenic
1058426455 9:104879344-104879366 ATTTTATAGTTGAGGAAAAAAGG + Intronic
1058494925 9:105546207-105546229 ATATTTCAGCTGAGGGGAAATGG - Intronic
1059015597 9:110512232-110512254 ATATTTAAGAAAAGGTAAAAGGG - Intronic
1059872123 9:118588950-118588972 ATATTTTATTAGAGAAATAAGGG - Intergenic
1059879044 9:118669132-118669154 CTAATTTATTAGAAGGAAAATGG - Intergenic
1060567242 9:124603978-124604000 AATTTTTAGTAGAGTGGAAAGGG - Intronic
1185936786 X:4265419-4265441 ATTTTTCAGTATAGGCAAAATGG + Intergenic
1186121684 X:6370327-6370349 CTATTTTACTGGAAGGAAAAAGG - Intergenic
1186203441 X:7176977-7176999 TTATTTTCATAGAGGCAAAATGG - Intergenic
1186260930 X:7778708-7778730 ATATTCTAGTAGGTGAAAAAGGG + Intergenic
1186890728 X:13956933-13956955 AGATTTTATCAGAAGGAAAAAGG + Intergenic
1187719140 X:22133330-22133352 ATCTTTTAGTGGTGGAAAAAAGG + Intronic
1188133150 X:26462705-26462727 ATATTTTTATATAGAGAAAATGG + Intergenic
1188249942 X:27880468-27880490 ATATTTTTGGAGATGGAAAAGGG - Intergenic
1188985271 X:36763363-36763385 ATGTCTTAGTAGAAGAAAAATGG - Intergenic
1189563283 X:42213249-42213271 ATATTTTTGTATAGAGAAAGGGG + Intergenic
1189846737 X:45145468-45145490 ATTTTTTTGTAGAGGCAACAGGG - Intergenic
1191184640 X:57596093-57596115 ATTATTCAGTAGAGGGAAGAGGG - Exonic
1193470989 X:81903112-81903134 ACATTTTAGTTGAGGTAAACTGG + Intergenic
1194268472 X:91781857-91781879 TTAATTTAGTCGAGGGAGAAAGG - Intronic
1194498245 X:94645889-94645911 CTATTTAAGTAGAAGGAAACTGG - Intergenic
1195279064 X:103311325-103311347 TCATTTTAGTGGAGAGAAAACGG - Intergenic
1197809178 X:130426450-130426472 CTATTTTATTAAAGAGAAAACGG - Intergenic
1197831927 X:130652124-130652146 CTATTTTAGTAGAGTGATAGAGG - Intronic
1198101240 X:133423844-133423866 ATACTTTACTACAGGGACAAAGG + Intergenic
1199746459 X:150774828-150774850 ATTTTTGATTTGAGGGAAAAGGG + Intronic
1200585671 Y:5002770-5002792 TTAATTTAGTCGAGGGAGAAAGG - Intronic