ID: 1000934152

View in Genome Browser
Species Human (GRCh38)
Location 5:167287964-167287986
Sequence GATTAGGGCTGGGTCTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000934152_1000934161 18 Left 1000934152 5:167287964-167287986 CCTGGTCAGACCCAGCCCTAATC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1000934161 5:167288005-167288027 CCACTTTGAATAATGAAGGTCGG 0: 1
1: 0
2: 1
3: 11
4: 158
1000934152_1000934159 14 Left 1000934152 5:167287964-167287986 CCTGGTCAGACCCAGCCCTAATC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1000934159 5:167288001-167288023 GATGCCACTTTGAATAATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000934152 Original CRISPR GATTAGGGCTGGGTCTGACC AGG (reversed) Intronic
904438627 1:30515487-30515509 GATGATGGGGGGGTCTGACCTGG + Intergenic
906286080 1:44588729-44588751 GCTTAGGGCTGGCTATGAGCAGG + Intronic
909946641 1:81671082-81671104 GATTAGGGCTGGTCCTGAACTGG - Intronic
917479552 1:175400085-175400107 GGTTAGTGCTGGGGCTGGCCAGG - Intronic
919750804 1:201036902-201036924 GACTTGGGCAGGGTCTGATCTGG + Intergenic
920747652 1:208644099-208644121 GACTGGGGCTGGGGCTGGCCTGG - Intergenic
921175325 1:212588272-212588294 GGTTAGGGCTGTTTCTGAGCAGG - Intronic
1062985115 10:1761392-1761414 GAAAAGGGCTGTGTCTGCCCCGG - Intergenic
1064904487 10:20330919-20330941 GAGTAGGGCTGGGTCTCCCAAGG - Intergenic
1067220699 10:44342115-44342137 GCTGAGGGCTGGGGCTGAGCAGG - Intergenic
1067696068 10:48536441-48536463 CAGTAGAGCTGGGTCTGACCTGG - Intronic
1069175493 10:65284534-65284556 GGTTTGGGCTGGGTCTGGGCTGG - Intergenic
1069999288 10:72364368-72364390 GAGTAGGGCTGGGTCTAGGCTGG + Intergenic
1073759263 10:106612465-106612487 GCTTAGGGATTGGTTTGACCAGG + Intronic
1074270203 10:111945808-111945830 GAATAGGGCTGAGGCTGACATGG + Intergenic
1074443669 10:113500353-113500375 GATTAGGCCTGGGGGTGTCCTGG - Intergenic
1075249207 10:120850675-120850697 GGGAAGGACTGGGTCTGACCTGG + Intergenic
1075562020 10:123474868-123474890 GATTAGGCATGGGTCAGAGCCGG + Intergenic
1078443753 11:11388663-11388685 GACCAGCGCTGGGGCTGACCTGG - Intronic
1079191841 11:18284640-18284662 AATGAGGGCTGAGTCTGGCCAGG - Intronic
1081679141 11:44989590-44989612 GAGGAGGGCTGGTCCTGACCTGG - Intergenic
1081998108 11:47377603-47377625 GATTGGGGCTGGGTGGGACCTGG - Intronic
1084273285 11:68039959-68039981 GAGGAGGGTTGTGTCTGACCTGG - Intronic
1084287732 11:68142702-68142724 GATCAGTGCTGGGGCTGGCCTGG + Intergenic
1084858371 11:72003080-72003102 GTCCAGGACTGGGTCTGACCTGG - Exonic
1085174325 11:74473338-74473360 GATTAGGGCTGTGCGTCACCAGG + Intergenic
1085315197 11:75540527-75540549 GAATGGGGCTGGGACTGACTGGG - Intergenic
1085401549 11:76238785-76238807 GGCTGGGGCTGGGTCGGACCTGG + Intergenic
1085508710 11:77074519-77074541 GATTTGGGCTGGCGCTGAGCTGG - Intronic
1087002221 11:93432590-93432612 AATTAGGGGTGGGTTTTACCAGG + Intronic
1090137306 11:124210761-124210783 GCCTAGGGGTGGGTCTTACCTGG + Intergenic
1094402635 12:30078501-30078523 GAGCAGGGCTGGGTTTGACCAGG + Intergenic
1099484646 12:83213669-83213691 GAACAGGGCTGTGTCTGAACAGG + Intergenic
1100140964 12:91618415-91618437 GAAGAGGCCTGAGTCTGACCAGG + Intergenic
1102533147 12:113561634-113561656 GCTTTGGGCTGGGCCAGACCGGG + Intergenic
1102999170 12:117372134-117372156 GATTTGGGCTGAGTCTTGCCTGG - Intronic
1103588109 12:121971182-121971204 GATTGGGCCTGGGCCTGGCCTGG + Intronic
1104086112 12:125475476-125475498 GATTAAGGCTGGGTCTGCCTTGG - Intronic
1108051160 13:46440582-46440604 CAGTGGGGCTGGGTCTGCCCGGG - Intergenic
1109543718 13:63814202-63814224 CAGTGGGGCTGGGTCTGCCCAGG - Intergenic
1112733529 13:102394009-102394031 TATTAGAGCTGGGGCTGATCTGG + Intronic
1113500608 13:110770894-110770916 CATGAGAGCTGGGGCTGACCGGG - Intergenic
1114547064 14:23510796-23510818 AACTAGGGCTGGTTCTGACCTGG - Intergenic
1119794277 14:77381579-77381601 CATTAGGGCTGGGTAGGCCCTGG + Intronic
1122052081 14:99067279-99067301 GAGCTGGGCTGGGTCTGAGCTGG - Intergenic
1122817742 14:104321859-104321881 GATCAGGGCTGGGGCCCACCAGG + Intergenic
1125921829 15:43529542-43529564 GGTTAGGGCTGGGTGTGGGCTGG + Intronic
1126143280 15:45454788-45454810 GAGGAGGGCTGGGGGTGACCTGG + Intergenic
1126307010 15:47271344-47271366 GGACAGGGCTGGGTCTTACCTGG + Intronic
1126361111 15:47846884-47846906 CATAAGGGCTGGGTCTGTCCTGG - Intergenic
1128291185 15:66479593-66479615 GATGAGGGCTGGGTCTTAGGAGG + Intronic
1129692386 15:77721201-77721223 GGTTAGGGCCGGGTCTCACGAGG - Intronic
1129726170 15:77902907-77902929 GACTTGGGCTGTCTCTGACCTGG + Intergenic
1137556942 16:49476667-49476689 GAGTTGGACTGGGACTGACCAGG - Intergenic
1141323348 16:83032772-83032794 GAATAGGGCTGACTCTGCCCTGG - Intronic
1141865591 16:86747759-86747781 GATGAAGGCTGGGTATGCCCAGG - Intergenic
1143724349 17:8835229-8835251 GACGAGGGCTGGGACTGACAAGG + Intronic
1143857485 17:9862976-9862998 GTTTAGACCTGGGTGTGACCTGG + Intronic
1148580196 17:48738368-48738390 GATCTGGGCTGGGTCTGGGCCGG - Intergenic
1151888980 17:76940983-76941005 GCTCAGGGCTGTGTCTGACCAGG - Intronic
1153643805 18:7176854-7176876 GGTGAGGGCTGGGTATAACCAGG + Intergenic
1155715342 18:28935769-28935791 GATGATGGCTGGGTCTCACAGGG - Intergenic
1160658850 19:289014-289036 GGCCAGGGCTGGGTCTGTCCTGG - Intronic
1160877602 19:1304464-1304486 GGGCAGGGCTGGGTCTGTCCTGG + Intergenic
1161163253 19:2772200-2772222 GATTCAGGCTGGGTCAGACAGGG + Intronic
1162930620 19:13955813-13955835 CATCAGGGCTGGGGCTGAGCGGG - Intronic
1162943624 19:14029137-14029159 GATTAGGGCAGAGTCTCAGCAGG + Intronic
1165435497 19:35792701-35792723 GATTAGGGAAGGGACTGAACAGG + Intergenic
1166265814 19:41683614-41683636 GGTCAAGGCTGGGTCTGCCCAGG + Intronic
1166282974 19:41807524-41807546 GGTCAAGGCTGGGTCTGCCCAGG - Intronic
1167687174 19:50963558-50963580 GAAGAGGGCTGGGTCTCACCTGG + Intronic
1168685531 19:58347225-58347247 GGTTAGCGCTGGGTCTCCCCAGG - Intronic
926286980 2:11496377-11496399 GAAAAGGACTGGCTCTGACCTGG + Intergenic
927482978 2:23468942-23468964 GACTTGGGATGGGCCTGACCAGG + Intronic
931227146 2:60341348-60341370 GGTCAGGCCTGGGACTGACCTGG - Intergenic
932460921 2:71881352-71881374 GATGAGGGCAGGGCCAGACCTGG - Intergenic
933760060 2:85666819-85666841 GATTAGGGGTCAGTCTGCCCTGG - Intronic
934477700 2:94604133-94604155 GAATCGGGCTGAGGCTGACCAGG + Intronic
934783711 2:96989273-96989295 GATTGGGGCTTGGTCTGGACTGG + Intronic
936734439 2:115424086-115424108 GATTAGCTATGGTTCTGACCAGG - Intronic
939998255 2:148940499-148940521 GATCAGGGCTGAGTCAGAGCTGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
946228196 2:218276007-218276029 GAGTGGGGCTGGGACTTACCAGG + Exonic
1169489125 20:6056383-6056405 TGCTAGGGCTGGGTATGACCAGG - Intergenic
1170360772 20:15543788-15543810 GACTAAGGCTAGGTCTGGCCAGG + Intronic
1170626521 20:18034256-18034278 GCTGAGGGCTGTGTCTGCCCTGG - Intronic
1170877318 20:20262426-20262448 GCTAAGGGCTGGATCTGAGCTGG - Intronic
1171432403 20:25091343-25091365 GAGCAGGGCTGGGGCTGGCCTGG + Intergenic
1172969211 20:38861308-38861330 TATTTGAGCTGGTTCTGACCTGG + Intronic
1173295198 20:41749457-41749479 GAATAGAGCTGGGTCAGAGCAGG - Intergenic
1173310682 20:41893723-41893745 CACAAGGGCTGGGGCTGACCTGG - Intergenic
1175823286 20:61923417-61923439 GATCAGGGCTGGGAGTGACCTGG - Intronic
1181510282 22:23385908-23385930 GCCTAGGGCAGGGGCTGACCAGG - Intergenic
1183744614 22:39685516-39685538 GGGCAGGGCCGGGTCTGACCTGG + Intronic
1185115205 22:48930430-48930452 GCTTAGGGCTGGGTTTGCACTGG + Intergenic
953927771 3:46991063-46991085 GATAAGAGCTGGCTCTGCCCTGG - Intronic
954683656 3:52359197-52359219 GATTGGGGCTGCGGCTGTCCAGG + Intronic
960400079 3:117186145-117186167 TATTTGGGCTGTGTCTAACCTGG + Intergenic
967824734 3:193869316-193869338 GGTTAGGGCTGGGTGTGCGCTGG - Intergenic
969443900 4:7233372-7233394 GATGAGGGCTACGTCTGCCCTGG - Intronic
969669218 4:8580535-8580557 GACCAGGGCAGGGACTGACCTGG + Intronic
976154543 4:82128553-82128575 GAGTTGGGCTGGGGGTGACCCGG - Intergenic
985693256 5:1325301-1325323 GATGAGGGCTGGGGCAGAGCTGG - Intronic
986709852 5:10480723-10480745 GATTCTGACTGGGTCTGAGCTGG - Intergenic
986737606 5:10679738-10679760 GAGGGGCGCTGGGTCTGACCAGG + Exonic
991632258 5:68667867-68667889 GATTAGGACCGGGTCGGACAAGG + Intergenic
994590086 5:101761155-101761177 GATTTTGGCTGGGATTGACCAGG - Intergenic
997472755 5:134125784-134125806 GAGTAGGGCAGGGCCTGCCCGGG + Intronic
997882097 5:137600439-137600461 GATTTGGGCTGGGTTTGGGCTGG - Intergenic
998138413 5:139686700-139686722 GATGTGGGCTGGGACTGACCAGG + Intergenic
998316171 5:141184591-141184613 GAGTTGGCCTGGGTCTGGCCGGG - Exonic
998781149 5:145658303-145658325 GTCTAGGGCTGGGTCTGTGCAGG - Intronic
1000934152 5:167287964-167287986 GATTAGGGCTGGGTCTGACCAGG - Intronic
1002458617 5:179361051-179361073 GCTTTGGGCTGGGTGTGTCCAGG - Intergenic
1003100962 6:3176263-3176285 GATGAGGGCAGTGTCTGTCCTGG + Intergenic
1005793038 6:29327067-29327089 AGTTAGGGCTGTGTCTGATCAGG + Intergenic
1007357522 6:41332400-41332422 GAGTATGGCTGGGTTTGGCCTGG - Intergenic
1013210421 6:107982163-107982185 GATTTCGGGTCGGTCTGACCAGG - Intergenic
1026489573 7:70851113-70851135 GTTTAGGTCTGGAGCTGACCAGG - Intergenic
1029694126 7:102201972-102201994 GCTCAGAGCTGAGTCTGACCGGG + Exonic
1029739450 7:102483300-102483322 GGTTCTGGCTGGGTCTGTCCTGG + Exonic
1029757451 7:102582479-102582501 GGTTCTGGCTGGGTCTGTCCTGG + Exonic
1029775391 7:102681540-102681562 GGTTCTGGCTGGGTCTGTCCTGG + Intergenic
1032242769 7:130177654-130177676 GGATAGGGCAGGGTCTGGCCAGG + Intronic
1032286215 7:130540066-130540088 GATTTGGGTTGGGACTGACTGGG + Intronic
1034344992 7:150380502-150380524 GATTAGGGATCGCTTTGACCAGG - Intronic
1034460582 7:151195849-151195871 GATTAGGCCTGGGTGTGAACAGG - Intronic
1035555590 8:564979-565001 GAAAAGGGCTGGGAATGACCAGG - Intergenic
1036522428 8:9504313-9504335 AATCAGGGCAGGGTCTGAGCAGG + Intergenic
1049219704 8:141423456-141423478 GATCAGGGCTCTGTGTGACCAGG + Intronic
1049263583 8:141653053-141653075 GATCAGGGCTCAGTGTGACCAGG + Intergenic
1049362319 8:142218117-142218139 GATCAGGGCTCCGTGTGACCAGG + Intronic
1049413073 8:142482175-142482197 GATCAGGGCTCAGTGTGACCAGG - Intronic
1049413092 8:142482291-142482313 GATCAGGGCTCAGTGTGACCAGG - Intronic
1049413131 8:142482503-142482525 GATCAGGGCTCAGTGTGACCAGG - Intronic
1049413219 8:142483031-142483053 GATCAGGGCTCAGTGTGACCAGG - Intronic
1049413327 8:142483597-142483619 GATCAGGGCTCAGTGTGACCAGG - Intronic
1049413336 8:142483643-142483665 GATCAGGGCTCAGTGTGACCAGG - Intronic
1050168924 9:2795463-2795485 GATTGGCCCTGGTTCTGACCAGG - Intronic
1052852260 9:33385423-33385445 GAATTGGGCTGAGGCTGACCAGG - Intronic
1053680361 9:40481974-40481996 GAATCGGGCTGAGGCTGACCAGG - Intergenic
1053930347 9:43110284-43110306 GAATCGGGCTGAGGCTGACCAGG - Intergenic
1054283351 9:63142961-63142983 GAATCGGGCTGAGGCTGACCAGG + Intergenic
1054293441 9:63317484-63317506 GAGTCGGGCTGAGGCTGACCAGG - Intergenic
1054391467 9:64621977-64621999 GAATCGGGCTGAGGCTGACCAGG - Intergenic
1054504260 9:65894350-65894372 GAATCGGGCTGAGGCTGACCAGG + Exonic
1055784827 9:79861740-79861762 GCTTGGGGGTGGGTCTGAACTGG + Intergenic
1056101646 9:83305568-83305590 GAATGGGCCTGGGACTGACCTGG - Intronic
1057258282 9:93568362-93568384 GCCTAGGGCTGGGCCTGACACGG - Intergenic
1057544436 9:96006995-96007017 AAAGATGGCTGGGTCTGACCAGG + Intronic
1061590775 9:131596252-131596274 GATTGGGGCTGGTCCTGCCCCGG - Intronic
1061875548 9:133541796-133541818 GATGAGGGCTGGGACAGAGCTGG - Intronic
1062465212 9:136677847-136677869 GATGAGGGCTGGGTGGGCCCTGG - Intronic
1062581354 9:137230545-137230567 GAGTATGGCTGGGGCTGCCCGGG - Intergenic
1199433203 X:147784025-147784047 GTTTAGGGCTGCCTATGACCAGG + Intergenic
1199744074 X:150761015-150761037 GAGCAGTGCTGGGTCTGCCCTGG + Intronic