ID: 1000939313

View in Genome Browser
Species Human (GRCh38)
Location 5:167341004-167341026
Sequence GACCCTCTTGGTTTGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000939310_1000939313 -8 Left 1000939310 5:167340989-167341011 CCCTCTTGGTTTGCAGACCCTCT 0: 1
1: 0
2: 1
3: 21
4: 256
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939309_1000939313 -4 Left 1000939309 5:167340985-167341007 CCGTCCCTCTTGGTTTGCAGACC 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939307_1000939313 0 Left 1000939307 5:167340981-167341003 CCTCCCGTCCCTCTTGGTTTGCA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939311_1000939313 -9 Left 1000939311 5:167340990-167341012 CCTCTTGGTTTGCAGACCCTCTT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939308_1000939313 -3 Left 1000939308 5:167340984-167341006 CCCGTCCCTCTTGGTTTGCAGAC 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000939313 Original CRISPR GACCCTCTTGGTTTGCAGAA TGG Intronic
902089520 1:13892566-13892588 GCCCCTTTTGGTTTGGAGCAGGG + Intergenic
902255865 1:15188258-15188280 GTCCCTCTGGGTTTGCAGGAAGG - Intronic
902796345 1:18803140-18803162 TACCGTCTTGTTTTGCAGGAGGG - Intergenic
902798297 1:18814005-18814027 TACCCTCTTGCTTTATAGAAGGG - Intergenic
903137831 1:21320954-21320976 GAACCTCCTGGTTTGGAAAAGGG + Intronic
905941176 1:41864615-41864637 GAACCTCTGGATATGCAGAATGG + Intronic
906143395 1:43546485-43546507 GACCCACATGGTTGGCAGGAAGG + Intronic
911582064 1:99645424-99645446 GACACTCTTGGCTTTCAGGAAGG - Intergenic
912966031 1:114238336-114238358 GAGCCTTTTGCTTTGCAAAAAGG + Intergenic
913550481 1:119912893-119912915 GATCCTTTGGGTTTGGAGAAAGG - Exonic
914907384 1:151757704-151757726 GACCCTCTTGTTTTGAAAGATGG - Intergenic
921958033 1:221004055-221004077 GACTCTCTTGGTGGGAAGAAAGG + Intergenic
1063744633 10:8866714-8866736 AAGTCTCTTGATTTGCAGAATGG - Intergenic
1066287490 10:33982345-33982367 GGCCCTCTGCCTTTGCAGAAAGG - Intergenic
1073885808 10:108038344-108038366 GACCCCCTTGTTTTGCAGAATGG - Intergenic
1074389921 10:113048526-113048548 AACCATCTTGGTTAGCACAAGGG + Intronic
1074817640 10:117154826-117154848 GAGCCTCCTGGGTTGCAGGATGG + Intergenic
1074824066 10:117202067-117202089 GCCCCTCTTGGCTGGCAAAAGGG + Intronic
1078359541 11:10657773-10657795 CACCCTCTGGATTTGCAGAAGGG - Intronic
1079358190 11:19747856-19747878 GAAGCTCCTGGTTTCCAGAAGGG - Intronic
1079864375 11:25716653-25716675 GATTCTCTTAGTTTTCAGAAAGG + Intergenic
1080297560 11:30747981-30748003 GCCCCTCTTTGTTTTCAAAAAGG + Intergenic
1080955248 11:37086095-37086117 GACTCTCTTGTTTTGAACAAAGG + Intergenic
1081860787 11:46332507-46332529 GACCCACTGGGTTTGGGGAAGGG - Intergenic
1084266838 11:68009353-68009375 GACCTCTTTGTTTTGCAGAAGGG + Intronic
1085535197 11:77213372-77213394 GACCCTCTGGGTGTGCAGCTGGG - Intronic
1085810507 11:79676500-79676522 GACTCATTTTGTTTGCAGAATGG + Intergenic
1086905172 11:92410417-92410439 GACCATTTTGGTTTGTGGAAGGG + Intronic
1088535710 11:110858614-110858636 GACCCTGTTTGTGTGCAGCATGG - Intergenic
1089004490 11:115079525-115079547 GCCTCTCTAGGTCTGCAGAATGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091637604 12:2209264-2209286 GACCATACTGGTTTGCAGAGGGG - Intronic
1093300917 12:17453353-17453375 GACTATCTTGGTTTGCTGATTGG + Intergenic
1094491377 12:30963048-30963070 GACCCTCCTGATTTGCAGATAGG - Intronic
1094754731 12:33454786-33454808 GGCCCTCTTGGTATACAGAACGG - Intergenic
1095105884 12:38232486-38232508 GACCCTCATAGTTTACATAATGG + Intergenic
1096869687 12:54585537-54585559 GACCCTCTAGGTTAGCAGTGGGG + Intronic
1098658647 12:73066605-73066627 GTGCCTCTTGGTTTCCAGACTGG + Intergenic
1099196443 12:79622166-79622188 CACCTTCTTGGTTTGCACAATGG - Intronic
1099766115 12:86987183-86987205 AACTCTCTTTATTTGCAGAAAGG + Intergenic
1100784278 12:98062773-98062795 AACCCTCGTGGTTATCAGAAGGG + Intergenic
1101090792 12:101282904-101282926 GACCTACTGGGTTTGCAGCAAGG + Intronic
1102989270 12:117303190-117303212 CACCCTTTTGGTTTTCAGCAAGG + Intronic
1106127634 13:26913395-26913417 GTCCCTCTGGGTTTCCAGACTGG - Intergenic
1107080736 13:36372181-36372203 GACCCTCTGTGTGGGCAGAAAGG - Intergenic
1109447815 13:62467157-62467179 GACATTCGTGGTTTGAAGAATGG - Intergenic
1109458781 13:62627097-62627119 GAGCCTCTTGCTTTGTAGAAAGG + Intergenic
1109667298 13:65556153-65556175 GTGCCTGCTGGTTTGCAGAATGG - Intergenic
1113313871 13:109158206-109158228 GTCACTCTTGGTTTGGAGCAAGG + Intronic
1115949644 14:38705682-38705704 GACCGTTTTGGTTTGCAGTTGGG - Intergenic
1119794183 14:77380865-77380887 GACTATCTTGGTAAGCAGAAGGG - Intronic
1120196131 14:81484965-81484987 GACCATTTAGGTTTGGAGAAGGG + Intronic
1122018611 14:98818376-98818398 AACCCTCTCATTTTGCAGAAGGG + Intergenic
1127282985 15:57507907-57507929 GACCCTTTTGTGTTGCAGAGGGG + Intronic
1128542605 15:68546215-68546237 GAACTTCTTCGTTTGCAAAATGG - Intergenic
1129372993 15:75109639-75109661 CACCCCCTTGGCTTGGAGAAGGG + Intronic
1129685188 15:77681952-77681974 GACCATCCTGGTTTCCAGGATGG + Intronic
1131404301 15:92151547-92151569 GACCCTCTTGTTTTTAAGATAGG + Intronic
1133573704 16:7067169-7067191 CACCCTCTGGGTTTGGTGAAAGG - Intronic
1134870897 16:17651590-17651612 GACACTCCTGGCTTGCAAAAGGG + Intergenic
1140205841 16:72932689-72932711 CACGCTGTTGGTTTGGAGAATGG - Intronic
1141161791 16:81633946-81633968 GACCCTCTTGGATGGAAGATTGG - Intronic
1142820118 17:2459313-2459335 CAACCTCTTGGTTTACAGACTGG - Intronic
1145289194 17:21529769-21529791 GACCCTCTGCCTTTGCAGAAAGG + Exonic
1147252942 17:39164702-39164724 GAGCCTTTGGGTTTGAAGAAGGG + Intronic
1148103128 17:45104841-45104863 GTCCCTGCTGCTTTGCAGAAAGG + Exonic
1149104390 17:52944252-52944274 GGCCCTCTGCCTTTGCAGAAAGG + Intergenic
1150253792 17:63727095-63727117 GACCCTGTTAGTTTGTAAAATGG + Intronic
1152425931 17:80218677-80218699 GACACTCTGGGTTTGGAGAAGGG - Intronic
1152931584 17:83112940-83112962 GCCCTTCCTGGTTTACAGAAAGG + Intergenic
1153002492 18:468383-468405 AACCCTTTTATTTTGCAGAAGGG + Intronic
1154310195 18:13261381-13261403 GAGCCTCTTCATTTGTAGAAAGG + Intronic
1160849018 19:1180755-1180777 GCCCTTCCTGGTGTGCAGAAGGG + Intronic
1164750243 19:30648395-30648417 GCGCCTGTGGGTTTGCAGAAAGG - Intronic
1165158632 19:33803072-33803094 GACCCTCCTGGTGTGCCCAAGGG + Intronic
1165839831 19:38781742-38781764 CACCCTCTAGCTTTGCAGCACGG - Intergenic
925232998 2:2252464-2252486 GTCCCTCCTGGATTGCAGAATGG - Intronic
926643201 2:15259743-15259765 AACCATCTTGGTTTGCAAATTGG - Intronic
936157821 2:110060466-110060488 TAACCTGTTGGTTTGCAGAGGGG + Intergenic
936186871 2:110310978-110311000 TAACCTGTTGGTTTGCAGAGGGG - Intergenic
936748583 2:115612312-115612334 AACACTCTTGCTTTCCAGAATGG - Intronic
939632656 2:144543933-144543955 GTCCATCCTGGTTTCCAGAAAGG - Intergenic
940986462 2:160056806-160056828 GGCCCTGTGGGTTTGCACAAAGG - Intronic
942062564 2:172241197-172241219 GACCCACTTGGTTTGGAGTTGGG - Intergenic
945357819 2:208859955-208859977 CAAACTCTTGGTTTTCAGAAGGG - Intergenic
946430174 2:219622020-219622042 GACCCTCCTGCTTTGCTGATGGG + Intergenic
946710473 2:222499974-222499996 GAACCCTTTGGTTGGCAGAAGGG + Intronic
946877682 2:224146422-224146444 TACCCTGTTTCTTTGCAGAAAGG + Intergenic
947332948 2:229049334-229049356 GACCCTCTTTGTTTCCACAGAGG + Intronic
948626870 2:239274879-239274901 GCTCCTCTTGGTTTGAAGGAGGG + Intronic
1173327516 20:42047390-42047412 GACCCTCTTCCTTTGAAGACAGG + Intergenic
1175878866 20:62244860-62244882 CACCCTCTTGGCATGGAGAATGG + Intronic
1179156676 21:38857260-38857282 GACCCTCTGGGTTTGCTGTGGGG + Intergenic
1179492633 21:41751318-41751340 CACCCTCTGAGATTGCAGAAGGG - Intronic
1181682521 22:24505658-24505680 CAGCCTCTTGGTGTGGAGAAAGG + Intronic
1183730526 22:39616088-39616110 GACCCTCTGGGTCTTCAGCACGG - Intronic
949393318 3:3587375-3587397 GGCCCTCTCCATTTGCAGAAGGG - Intergenic
949644310 3:6075672-6075694 GGGACTCTTGGTTTGGAGAAAGG + Intergenic
949898640 3:8791833-8791855 GGCCCTCATGCTTTGCTGAATGG - Intronic
950665479 3:14492436-14492458 GACCCTCTTCATTTTGAGAAGGG - Exonic
952596465 3:35024709-35024731 TGCCATCCTGGTTTGCAGAAAGG + Intergenic
952860934 3:37811704-37811726 AACCATCTCGGTTTGCAAAAGGG - Intronic
953381239 3:42474307-42474329 GACCCTGGTGGTTTGGAGGATGG - Intergenic
962979143 3:140472127-140472149 GACCCTCTGGGTATGGTGAAGGG - Intronic
963870899 3:150411719-150411741 GACCTTCTGGTTTTCCAGAAAGG - Intronic
964122764 3:153203540-153203562 TACCCTCTTGATGTGGAGAAGGG + Intergenic
964633406 3:158836412-158836434 GCCCCTCATACTTTGCAGAAGGG + Intergenic
966647403 3:182261930-182261952 GGCCCTATTGGTTTGAAGTATGG - Intergenic
967228422 3:187314730-187314752 CACCCTCATGCTTTGCAGAAGGG - Intergenic
967529428 3:190531976-190531998 AAACCTCTGGCTTTGCAGAAAGG + Intronic
968609181 4:1549370-1549392 GACCCACTGGGTCTGCAGTAGGG - Intergenic
972448014 4:39165582-39165604 GACCACCTTGGTCAGCAGAAGGG - Intergenic
972631619 4:40847137-40847159 TACCATCTTGGCTTTCAGAAAGG - Intronic
973159234 4:46994359-46994381 GACACTCTTCTTTTTCAGAATGG + Exonic
976521560 4:86033671-86033693 AGCCCTCTTGGTTTGTTGAAAGG - Intronic
981286564 4:143025320-143025342 GACTCTGTTTGTTTGGAGAAAGG + Intergenic
981650038 4:147046962-147046984 TCCCATCTTGGTTTGCAGCAAGG + Intergenic
981728924 4:147877059-147877081 GGCCCTGTTGGTTGTCAGAAGGG + Intronic
984251441 4:177340563-177340585 GAACCTCTTGCTCTGCAGATCGG + Intronic
985640246 5:1060247-1060269 GACCCTCGTGGGCTGCAGGAGGG + Intronic
985912678 5:2896065-2896087 GCCCCTCTGGGTTTGCGGCATGG - Intergenic
987391375 5:17378822-17378844 GATTCTCTTGGGTTGCAGAGAGG + Intergenic
992474469 5:77088375-77088397 GACCCTCTGCGCTTGCAAAAAGG - Intergenic
994717456 5:103338811-103338833 GACCCTCTCATTCTGCAGAAAGG - Intergenic
1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG + Intronic
1004247069 6:13988960-13988982 GACCCTAATGGTTTTCAAAATGG - Intergenic
1004247074 6:13989059-13989081 GACCCTAATGGTTTTCAAAATGG - Intergenic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1007838849 6:44699034-44699056 CAACCTCTGGGTTTACAGAATGG - Intergenic
1008713695 6:54262204-54262226 GAACTTCTGGGTTAGCAGAAAGG - Intronic
1012747261 6:103108238-103108260 GATGCTTTTGGTTTGCATAATGG - Intergenic
1013206577 6:107952121-107952143 TACTCTCTTGGTTTGCAAATTGG - Intronic
1013993861 6:116284203-116284225 GACATTTTTGTTTTGCAGAAAGG + Intronic
1018592393 6:165441809-165441831 TGCCCTACTGGTTTGCAGAAAGG + Intronic
1021518287 7:21510725-21510747 AACCCTCTTGCTTTGTAGATGGG + Intronic
1032542884 7:132718269-132718291 GATCCTCTAGGTTTGCTGGAGGG - Intronic
1033904828 7:146190234-146190256 TATCTCCTTGGTTTGCAGAATGG - Intronic
1035617500 8:1012936-1012958 GACCCCCTCTGTTTGCAGAGAGG - Intergenic
1038131853 8:24741079-24741101 GTCTATCTTGGTTTGCAGATGGG + Intergenic
1038820035 8:30943658-30943680 AACCGTCTGGGTCTGCAGAAGGG - Intergenic
1039897613 8:41727344-41727366 TCCTCTCTTGGTTTACAGAAAGG - Exonic
1040615873 8:49037805-49037827 GAACCTCCTGGTTTGCAGGATGG + Intergenic
1041188979 8:55333780-55333802 CACACTCCTGGTTTGTAGAAAGG + Intronic
1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG + Intergenic
1047864983 8:129013380-129013402 GACCCTCTGGGTTTGAAGAGAGG + Intergenic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1055251696 9:74315352-74315374 GAGCCTCCTGGCTTTCAGAATGG + Intergenic
1056056165 9:82826284-82826306 GACACTCTTGGTATGGAGGAGGG - Intergenic
1062206868 9:135342295-135342317 CTCCTTCTTGGTTTGCACAAAGG - Intergenic
1189174176 X:38937686-38937708 CCCACTCTTAGTTTGCAGAAAGG - Intergenic
1190483052 X:50897001-50897023 GACCCTCTGCCCTTGCAGAAAGG - Intergenic
1194835173 X:98672732-98672754 CACTCTCTTGGCTTGCACAAGGG + Intergenic
1197739263 X:129876735-129876757 GGCCCTCTGCCTTTGCAGAAAGG + Intergenic
1198149292 X:133892516-133892538 GACCTTCCTGGTATGCAGAATGG - Intronic
1199491559 X:148405724-148405746 GAGCATCTTGGTTTCCAGAAGGG - Intergenic
1199522157 X:148748518-148748540 GACACTCATGGATGGCAGAAAGG - Intronic