ID: 1000939313

View in Genome Browser
Species Human (GRCh38)
Location 5:167341004-167341026
Sequence GACCCTCTTGGTTTGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000939307_1000939313 0 Left 1000939307 5:167340981-167341003 CCTCCCGTCCCTCTTGGTTTGCA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939311_1000939313 -9 Left 1000939311 5:167340990-167341012 CCTCTTGGTTTGCAGACCCTCTT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939308_1000939313 -3 Left 1000939308 5:167340984-167341006 CCCGTCCCTCTTGGTTTGCAGAC 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939309_1000939313 -4 Left 1000939309 5:167340985-167341007 CCGTCCCTCTTGGTTTGCAGACC 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143
1000939310_1000939313 -8 Left 1000939310 5:167340989-167341011 CCCTCTTGGTTTGCAGACCCTCT 0: 1
1: 0
2: 1
3: 21
4: 256
Right 1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG 0: 1
1: 0
2: 1
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000939313 Original CRISPR GACCCTCTTGGTTTGCAGAA TGG Intronic