ID: 1000945418

View in Genome Browser
Species Human (GRCh38)
Location 5:167417293-167417315
Sequence GGGCCAGGGATGGACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 483}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000945418_1000945423 -3 Left 1000945418 5:167417293-167417315 CCAGCACAGTCCATCCCTGGCCC 0: 1
1: 0
2: 1
3: 30
4: 483
Right 1000945423 5:167417313-167417335 CCCCTGCCATCATTCTATACTGG 0: 1
1: 0
2: 0
3: 1
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000945418 Original CRISPR GGGCCAGGGATGGACTGTGC TGG (reversed) Intronic
900091704 1:923716-923738 GGGACTGGGATGGGCTGGGCTGG - Intergenic
900299306 1:1969132-1969154 TTGGCAGGGATGGACTGGGCAGG - Intronic
900325381 1:2106173-2106195 GAGCCAGGGAAGGACAGGGCCGG + Intronic
900415853 1:2534410-2534432 GGGCCTGGGAAGGATTGTGGGGG - Intergenic
900420879 1:2555475-2555497 GGGCCAGGGCTGGACCCTGGAGG + Intergenic
900714279 1:4133878-4133900 GAGCCAGGGAAGGAGTGGGCCGG - Intergenic
900824865 1:4918387-4918409 GGGCCAGGGTTGGAATGTTATGG - Intergenic
900932249 1:5744540-5744562 GGTCCAGGGAGGGGCTGAGCTGG - Intergenic
900945775 1:5830698-5830720 GGGACAGGGAGGGAGTGGGCAGG - Intergenic
900993966 1:6110357-6110379 GGGCCAGGGCTGCACGGGGCAGG - Intronic
901280117 1:8026950-8026972 GGGACAGTGAGGGACTGTGTAGG + Intergenic
901631956 1:10652325-10652347 CGGTCAGGGATGGTCTGTCCCGG - Intronic
902704305 1:18193803-18193825 GGGGCAGGGATGGACAGGGTGGG + Intronic
902792593 1:18779073-18779095 GAGCCTGGGAAGGGCTGTGCAGG + Intergenic
903225692 1:21893210-21893232 GGCCCAGGATTGGCCTGTGCTGG + Intronic
903664817 1:24999820-24999842 GGGCCAGAGATTGGCTGAGCGGG - Intergenic
904023998 1:27490631-27490653 TTGCCCCGGATGGACTGTGCAGG - Intergenic
904428687 1:30447941-30447963 AGGGGAGGGATGGACAGTGCTGG + Intergenic
904666436 1:32125434-32125456 TGGCAAGAGATGGCCTGTGCAGG - Intronic
904803158 1:33111116-33111138 AGGCCAGGGCTGAACTGTGAAGG + Intronic
906525508 1:46491023-46491045 GGGGCCCTGATGGACTGTGCAGG + Intergenic
906559915 1:46748827-46748849 AGGCCAGGGATGACCTGGGCTGG + Intergenic
906573198 1:46862407-46862429 GTGCCAGTGATGGACTGGGCAGG - Intergenic
906694781 1:47816625-47816647 GGATCAGGGAAGGAGTGTGCAGG - Intronic
908729323 1:67209328-67209350 GGGCCAGGGATGGAATGACATGG + Intronic
910445397 1:87294696-87294718 GGACCAGGCAGGGACTGTGGTGG + Intergenic
911686149 1:100780018-100780040 GGGCCAGGGATGGAATGATATGG - Intergenic
912117749 1:106427634-106427656 GGGCCAGGGATGGAATGATGTGG + Intergenic
912495641 1:110089605-110089627 GGGCCAGGGAGGGAAAGGGCTGG - Intergenic
912708743 1:111934276-111934298 AGGCCAGAGATGGAATGGGCTGG - Intronic
913277956 1:117157651-117157673 GGGCCAGGGATGGAATGATATGG - Intronic
914449811 1:147781122-147781144 GAGCCAGGGAAGGGCTGAGCTGG - Intergenic
914757156 1:150569693-150569715 GAAGCAGGGATGGACTGTGTAGG - Intergenic
915473448 1:156138960-156138982 GGGGCAGGGCTGGAGTGTGAGGG + Intronic
915560586 1:156684914-156684936 GGGCCAGGGTTAGGCTGGGCTGG + Intergenic
915563908 1:156703484-156703506 GAGCCAGGGATGCACTAGGCGGG + Intronic
915932375 1:160068551-160068573 GGTCCAGGGCTGGATTGTGGAGG - Intronic
917524969 1:175780439-175780461 AGGCCAGGGCTTTACTGTGCAGG - Intergenic
917920482 1:179745441-179745463 GGGTGAGGACTGGACTGTGCTGG - Intronic
918914293 1:190615465-190615487 GGGCCAGGGATGGAATGATATGG - Intergenic
919036967 1:192324818-192324840 TGGCCTGGGATGGACTTTGTAGG - Intronic
920514380 1:206573917-206573939 GGGCCACAGGTGGCCTGTGCTGG - Intronic
920517874 1:206599913-206599935 GAGCTAGGCAGGGACTGTGCAGG + Intronic
921896607 1:220407856-220407878 GGGCCAGTGATGGACTGAACAGG + Intergenic
922366524 1:224869771-224869793 GGGGCAGGGATTGACTGTGAAGG + Intergenic
922908073 1:229191161-229191183 GGGGCAGGGATGGAGTGGACGGG + Intergenic
923687495 1:236163459-236163481 GGGCCAGGGATGGAATGATATGG + Intronic
1062882197 10:988112-988134 GGGCCAGGGTTGGAGGGTCCGGG - Exonic
1062997219 10:1878046-1878068 GGGCCAGGGTTGGGGTTTGCAGG - Intergenic
1064140433 10:12785586-12785608 AGGCCCCGGAGGGACTGTGCTGG + Intronic
1065048476 10:21765918-21765940 GTGACAGGGGTGGACAGTGCAGG + Intronic
1065168138 10:23001997-23002019 TGGGCAGTGATGGTCTGTGCTGG + Exonic
1067478015 10:46578952-46578974 GGGCCAGGGACGGGCTGGGGCGG + Intronic
1068363489 10:56012469-56012491 GGCCCAAGGATGGACTGCTCTGG - Intergenic
1069580051 10:69559665-69559687 AGGCCAGGGATGGAGTGAGGAGG + Intergenic
1069692530 10:70363352-70363374 GGGCCAGGGAGAGACTTTTCTGG - Intronic
1070130656 10:73653339-73653361 GGGCCAGGGATAGTAGGTGCTGG + Exonic
1070161829 10:73871564-73871586 TGGCCAAGGATGGAAGGTGCAGG - Intronic
1070651982 10:78243962-78243984 GGGCCAGGGATGGAATGATATGG + Intergenic
1070801169 10:79245177-79245199 GAGCCAGGGGAGGGCTGTGCAGG - Intronic
1070830700 10:79416436-79416458 GGGCCCTTGATGAACTGTGCTGG + Intronic
1071874493 10:89829892-89829914 TGACAAGGGATGGACCGTGCTGG + Intergenic
1072135812 10:92544610-92544632 GGGCTAGGGAAGGACTGTGAGGG - Intronic
1072763658 10:98079024-98079046 GAGCCAGGCAGGCACTGTGCTGG + Intergenic
1072806498 10:98427014-98427036 GGTCCAGGAATGGGCTGTGAGGG - Intronic
1073121416 10:101124540-101124562 GAGCCAGGGCTGGACTGTGCTGG - Intronic
1073422010 10:103432030-103432052 TGGCCACGGATTGACTGTACGGG - Intronic
1074015384 10:109529091-109529113 GGGGCAGGGTGGGGCTGTGCTGG - Intergenic
1074167207 10:110892610-110892632 TGGTCAGTGATGGACTGTGTGGG + Intronic
1075530442 10:123224700-123224722 GGGCCAGGGATGGAATGATATGG - Intergenic
1075914901 10:126158559-126158581 GGGGCAGGGATGCACAGAGCCGG + Intronic
1076300782 10:129424805-129424827 GCTCCAGGTATGTACTGTGCTGG - Intergenic
1076759967 10:132599057-132599079 GGGCCAGGGATGGAATGATATGG - Intronic
1077113369 11:871773-871795 GGGTCACAGATGGACAGTGCAGG + Intronic
1077371219 11:2182471-2182493 GGGCCTGGGATGAACTCAGCTGG + Intergenic
1077444597 11:2585097-2585119 AGGCCAGGTATGGTCAGTGCTGG - Intronic
1077845270 11:6015966-6015988 GGGCCAGGGATGGAATGCTATGG + Intergenic
1078759827 11:14243065-14243087 GGGGAAGGGATGGGCTGAGCTGG + Intronic
1079025343 11:16943424-16943446 GGGGGAGGGAGAGACTGTGCAGG - Intronic
1080397397 11:31902766-31902788 GGGCCAGGGCTGAACTGTGAAGG + Intronic
1080464888 11:32487404-32487426 GGGCCAGGGAAGGACTCTTTGGG + Intergenic
1081157894 11:39716916-39716938 GGGCCAGGGGTGGACTGATATGG + Intergenic
1081458681 11:43250894-43250916 GGGCCATGGAGGGACTGAGGAGG - Intergenic
1083428654 11:62602409-62602431 GGGCCAGGGAAGGGCAGGGCGGG + Exonic
1083827503 11:65211779-65211801 GGGCCAGGGAAGGACAGAGGGGG - Exonic
1084150307 11:67285047-67285069 GGGCCAGGGATGGGTGGTGCAGG - Intronic
1084422573 11:69067615-69067637 GGGCCAGGGAGGGACCGTGGGGG + Intronic
1084605473 11:70169454-70169476 GGGCCTGGGAGGGAGGGTGCAGG - Intronic
1084686917 11:70701759-70701781 GAGACAGGGAAGGCCTGTGCAGG - Intronic
1085036347 11:73302509-73302531 GGCCCAGGGATGGAGTTTCCAGG + Intergenic
1085109308 11:73873621-73873643 TGGCCAGGGAGGGACTGAGGGGG - Intronic
1087856148 11:103093696-103093718 GGGACAGGGATGGAGTAAGCCGG + Intergenic
1088911418 11:114195372-114195394 GGGCCAGGGCTGGTCTGTGTGGG + Intronic
1089522821 11:119076984-119077006 TGGCCAGGGATTGTCGGTGCAGG - Exonic
1089533666 11:119148359-119148381 GGGCAAGGGAGAGAATGTGCAGG + Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1090839142 11:130474017-130474039 GGGCCTGAGGTAGACTGTGCGGG - Exonic
1091603248 12:1930383-1930405 GGGCCAGGGACAGAGTGGGCAGG - Intergenic
1091624114 12:2109555-2109577 GGGCCAGGGCCAGTCTGTGCAGG + Intronic
1091780867 12:3213834-3213856 GGGGCAGGGAGGGGCTGGGCTGG + Intronic
1092114483 12:5989163-5989185 GAGCCAGGGACAGCCTGTGCAGG + Intronic
1093487277 12:19665627-19665649 GGGCCTGTGATGGCCTGTGATGG - Intronic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1095178812 12:39123378-39123400 AGGGCAGTGCTGGACTGTGCTGG - Intergenic
1095300710 12:40581201-40581223 GGGCCAGGGATGGAATGATATGG - Intergenic
1095345775 12:41147536-41147558 GGGCCAGGGATGGAATGATATGG - Intergenic
1095969608 12:47892509-47892531 GGGCCAGGGATAGGATGTGGCGG + Intronic
1096231216 12:49897885-49897907 GGGGCAGGGATGGCTTCTGCAGG + Intronic
1096522531 12:52192219-52192241 GGGCCAAGGCTGGACTGGCCGGG + Intergenic
1096714276 12:53481990-53482012 GGGCCAGGGATGACCTCTGAAGG + Exonic
1098359309 12:69639435-69639457 GGGACATGGATGGACAGGGCTGG - Intergenic
1099654961 12:85478526-85478548 GGGCCAGGGATGGAATGATATGG - Intergenic
1099769045 12:87029230-87029252 GGGCCAGGGATGGAATGATGTGG - Intergenic
1099845118 12:88019074-88019096 GGGCCAGGGATGGAATGATATGG + Intronic
1102037893 12:109782662-109782684 TGGCCAGGGGTTGACAGTGCAGG - Intergenic
1102775196 12:115512508-115512530 GGGCCAGGGTTGGGCTGTAAGGG + Intergenic
1103009646 12:117448338-117448360 GAGGCAGGTATGGCCTGTGCAGG - Intronic
1103263614 12:119610444-119610466 GGGCCATGGATGGAATGTTGTGG + Intronic
1104079732 12:125419618-125419640 GGGCCAGGGATGGAATGATATGG - Intronic
1104276562 12:127333829-127333851 GGGCCAGTGATGTTCTGTGGTGG + Intergenic
1104759712 12:131289633-131289655 GGGGCCGGGATGGACTCTCCTGG - Intergenic
1104983521 12:132584218-132584240 GGGCCAGGGCTGGCCTGAGTGGG - Exonic
1105209609 13:18250095-18250117 GTCCCAGGGATGGATGGTGCCGG - Intergenic
1105281028 13:18962731-18962753 GGGCCGGGGAAGGCCTGTGCTGG - Intergenic
1105290230 13:19048743-19048765 GGGCCGGGGAAGGCCTGTGCTGG - Intergenic
1105462721 13:20607199-20607221 GGGCCTGAGATGGGCGGTGCAGG - Intronic
1106734907 13:32578750-32578772 GGGCCAGGGATGGAATGATATGG + Intergenic
1106906361 13:34413641-34413663 GGGCTAAGGATGGACAGTGGTGG + Intergenic
1107036485 13:35907651-35907673 GGGCCTGGGATGGCCTCTGCAGG - Intronic
1107560553 13:41553535-41553557 GGGCCAGGGATGGACTCAGAGGG - Intergenic
1108724214 13:53163035-53163057 GGGCCAGGGATGGAATGATATGG - Intergenic
1109780674 13:67106905-67106927 GGGCCAAGGCTGCAGTGTGCTGG - Intronic
1109994545 13:70107290-70107312 GTGCCAGGCATGGACTTTCCTGG - Exonic
1111539228 13:89649812-89649834 GGGCCAGGGATGGAATGATATGG - Intergenic
1111870131 13:93821480-93821502 GGGCCTGGGATGCACAGTTCAGG + Intronic
1112259195 13:97863100-97863122 GGGCCAGGGATGGAATGATATGG - Intergenic
1113085651 13:106567488-106567510 GGGCCGGGGCGGGACGGTGCGGG - Intronic
1113389814 13:109884811-109884833 GGGCCTGGGAGGGACGGTGGAGG - Intergenic
1113567499 13:111327542-111327564 GGGCCACCGAGGGACTGGGCTGG - Intronic
1113884835 13:113653092-113653114 GGGCCAGGGCAGGACAGGGCTGG - Intronic
1113961439 13:114128476-114128498 GGGCCAGGGAGGCACAGTCCAGG + Intronic
1114424734 14:22612129-22612151 GGGTCAGGGGTGGATTGAGCTGG - Exonic
1114659641 14:24335983-24336005 GGGGCAGGGAGGGACTGGGATGG - Intronic
1115591900 14:34873880-34873902 GGGCCAGGGGTGGAGGGCGCGGG - Intronic
1116199206 14:41770275-41770297 GGGCCAGGGATGGAATGACAAGG - Intronic
1116583300 14:46670265-46670287 GGGTCAGGAAAGGACTCTGCAGG + Intergenic
1117756031 14:58975097-58975119 TGGCCAGGGATGGACTGCTTTGG - Intergenic
1117977156 14:61310125-61310147 GGGCCAGGGATGGAATGATATGG - Intronic
1118177634 14:63457637-63457659 GGAGCAGGGATGGCCTCTGCTGG - Intronic
1118495977 14:66308524-66308546 GGGCCAGGGATGGAATGATATGG - Intergenic
1120082916 14:80236148-80236170 GGGCCAGGGATGGAATGATATGG - Intronic
1120291651 14:82580956-82580978 GGGCCAGGGGTGGACTGGAATGG + Intergenic
1121118155 14:91357960-91357982 GGACCAGGGGTGGCCTCTGCAGG + Intronic
1121403682 14:93704815-93704837 GGGCCAGGTAAGGGCTCTGCAGG + Intronic
1121630279 14:95416780-95416802 GGGCCAGGGATCGAGGGTCCAGG - Intronic
1122052218 14:99067747-99067769 GGGCTATGGCTGGACTGGGCTGG - Intergenic
1122052260 14:99067888-99067910 GGGCTGGGGCTGGACTGGGCTGG - Intergenic
1122339432 14:101018735-101018757 GGGGCAGGAAAGGGCTGTGCTGG - Intergenic
1123036956 14:105475406-105475428 GGGCCAGGTTTGGACTCTGTCGG + Intronic
1123059982 14:105590227-105590249 TGGGCTGGGCTGGACTGTGCTGG - Intergenic
1123080513 14:105691617-105691639 GGGCCAGGCCTGGGGTGTGCAGG - Intergenic
1124175405 15:27419197-27419219 GGGCCAGAGCTGGAAGGTGCAGG - Intronic
1125107455 15:35989689-35989711 GGGCTAGGCTTGGAATGTGCAGG - Intergenic
1125748456 15:42012934-42012956 GGGCCAGGGGTGGGCAGTGTGGG + Intronic
1126399704 15:48256803-48256825 GGGCCAGGGATGGAATGATATGG - Intronic
1126690870 15:51288201-51288223 GGGCCAGGGATGGTAGGGGCTGG - Intronic
1127641896 15:60923916-60923938 GGGCCAGGCATGGACTAAGGGGG - Intronic
1128250840 15:66163425-66163447 GCTCCAGTGATGGACTGGGCAGG + Intronic
1128422130 15:67503008-67503030 GGGCTGGGGATGTACTGTGCTGG + Intergenic
1128944448 15:71811438-71811460 GGGCCAGGGCAGGGCTGGGCCGG - Intronic
1129265741 15:74392284-74392306 GGGACAGTGATGGAGTGGGCAGG - Intergenic
1129629037 15:77236685-77236707 GGGCCAGGGATGGAATGATATGG + Intronic
1129893486 15:79087414-79087436 GGGCCAGGGATGGTTTTTGAAGG - Intronic
1130668658 15:85891066-85891088 TGGGAAGGGATGGACTGTGGGGG - Intergenic
1131269036 15:90935412-90935434 AGGCCAGGGATGGTCAGGGCGGG - Intronic
1131693192 15:94847893-94847915 GGGCCAGGGATGGTCAATGACGG + Intergenic
1132374827 15:101322174-101322196 GGGCCGGGGATGGGCTGTAGCGG - Intronic
1132410824 15:101577179-101577201 GGGCCAGGGATGCAGAGAGCCGG - Intergenic
1132535528 16:477582-477604 AGGACAGGGCTGGCCTGTGCTGG - Intronic
1132544267 16:526109-526131 GTGCCAGGGAAGGACTGGGAAGG + Intergenic
1132644486 16:992487-992509 GGGGCTGAGATGGACTGTCCGGG + Intergenic
1132652734 16:1028909-1028931 GGTCCTGGGATGCTCTGTGCGGG + Intergenic
1132835217 16:1949780-1949802 GGGGCAGGTATGGACGGGGCAGG + Intronic
1132835222 16:1949795-1949817 GGGGCAGGTATGGACGGGGCAGG + Intronic
1132835227 16:1949810-1949832 GGGGCAGGTATGGACGGGGCAGG + Intronic
1132835274 16:1949960-1949982 GGGGCAGGTATGGACGGGGCAGG + Intronic
1132835278 16:1949975-1949997 GGGGCAGGTATGGACAGGGCAGG + Intronic
1132835302 16:1950065-1950087 GGGGCAGGTATGGACGGGGCAGG + Intronic
1132835312 16:1950095-1950117 GGGGCAGGTATGGACGGGGCAGG + Intronic
1132835321 16:1950125-1950147 GGGGCAGGTATGGACAGGGCAGG + Intronic
1132838492 16:1966726-1966748 GGGCAAGGGCTGGGCTGTACGGG + Intergenic
1132994378 16:2815376-2815398 GGGCCAGGCTTGGCCTCTGCGGG + Intergenic
1133098628 16:3465498-3465520 GAGCCAGGGCTGGATTGTGGTGG - Intronic
1133232396 16:4372811-4372833 GGCCCAGGGGTGGAGTGTGCAGG + Intronic
1133334920 16:5000785-5000807 GGGCCTGGGAAGGACTGTGTGGG + Intronic
1133590949 16:7242831-7242853 TTGCCAGGTTTGGACTGTGCTGG + Intronic
1134915097 16:18062678-18062700 GGGGCAGGGAGGGGCTCTGCGGG + Intergenic
1135197234 16:20404530-20404552 GGGCCAAGGTGGGGCTGTGCTGG + Exonic
1137618165 16:49858739-49858761 GGCCCAGGGATGGACGGAGTTGG + Intergenic
1138346975 16:56326105-56326127 GGGCCAGGACAGGAGTGTGCTGG - Intronic
1139336637 16:66236512-66236534 GGGCCACGGATGGCGTCTGCTGG - Intergenic
1139591107 16:67933731-67933753 GGCCCAGGGAGGGTCTATGCCGG - Intronic
1139967803 16:70755278-70755300 GGGCCTGGGAAGGAAGGTGCAGG + Intronic
1141476363 16:84276186-84276208 AGGACAGGGAGGGGCTGTGCAGG + Intergenic
1141950336 16:87335523-87335545 GTGCCAGGGATGAGCTTTGCAGG + Intronic
1142807858 17:2380825-2380847 GGGGCAGGGCTGGGCTGGGCAGG - Exonic
1143166712 17:4900549-4900571 GGGCTAGGGAGGCACTGAGCCGG + Exonic
1143276387 17:5714492-5714514 GGGCCAGGGAGAGACGGAGCAGG - Intergenic
1143481104 17:7227831-7227853 GAGTCAGGGAGGGACTGGGCTGG - Intronic
1144032550 17:11335502-11335524 TGGCCAGGGAAAGGCTGTGCTGG - Intronic
1144625911 17:16844429-16844451 GGGCAAGGGAGGGGCTGGGCGGG - Intergenic
1144704927 17:17362113-17362135 GGTCCTGGGATAGCCTGTGCTGG + Intergenic
1144754170 17:17669417-17669439 GAGCCAGGGAGGGGCTGGGCTGG - Intergenic
1144880522 17:18428291-18428313 GGGCAAGGGAGGGGCTGGGCGGG + Intergenic
1145151713 17:20516096-20516118 GGGCAAGGGAGGGGCTGGGCGGG - Intergenic
1145910701 17:28540463-28540485 GGCCCAGGGTTGGACAGAGCTGG - Intronic
1146599831 17:34204818-34204840 GGGCCAGGGATGGCCTGGAACGG - Intergenic
1147158985 17:38559814-38559836 GAGCCTGGGAAGGACTGGGCTGG + Intronic
1148049272 17:44761094-44761116 GGGCCGGGGATGGGGTGTCCTGG + Intronic
1148152594 17:45405310-45405332 GGGGCAGGGCTGGAGTGGGCGGG - Intronic
1148405507 17:47410447-47410469 GGGCCAGGGATGGAATGCTATGG - Intronic
1149135650 17:53360234-53360256 GGGCCAGGGATGGAATGATATGG + Intergenic
1150343440 17:64386906-64386928 AGGCCAGGGCTGGACTGTGAAGG + Intronic
1151249911 17:72826045-72826067 GGGCCAGGGATGGAATGATATGG + Intronic
1151346242 17:73503802-73503824 TGGTCAGGGATGGTCTGAGCTGG + Intronic
1151660280 17:75515187-75515209 GGGCCTGGGCTGGGCTGGGCTGG - Intronic
1151701400 17:75744454-75744476 GGGACAGGAATGGTCTGGGCAGG - Intronic
1151948203 17:77330825-77330847 GGGCCAGGCAGGGACAGTGAAGG - Intronic
1152145971 17:78569082-78569104 GGGGTAGGGATGGACGCTGCAGG + Intronic
1152722923 17:81931640-81931662 GGGACACAGATGGACGGTGCTGG - Intergenic
1152792893 17:82291795-82291817 GGGCCAGGGATGGGCTCTGAGGG + Intergenic
1152820794 17:82436781-82436803 GGGCCAGGGATGGCCTTCCCAGG - Intronic
1152986016 18:321742-321764 GGGCCAGGAGAAGACTGTGCTGG - Exonic
1153011828 18:546637-546659 GGGCCAGGGATGGAATGATATGG - Intergenic
1153682895 18:7517295-7517317 GGGACAGGGGAGGAGTGTGCAGG + Intergenic
1153846241 18:9052048-9052070 GGGCCAGGGATGGAATGATATGG + Intergenic
1155455307 18:26005531-26005553 GGGCCAGGGATGGACTGCTATGG + Intergenic
1155717687 18:28967449-28967471 GGGTCAGGGATGGAAAGTGGAGG + Intergenic
1156467314 18:37356014-37356036 AGGCCAGGGCTGGGCTGGGCTGG - Intronic
1157764507 18:50286512-50286534 GGGCCATGGATGGACAGGGAAGG - Intronic
1157788410 18:50507502-50507524 GGGCCAGGGTAGGTCTGGGCTGG - Intergenic
1157893218 18:51438655-51438677 AGGCCAGGGATGGTCTGGGTTGG + Intergenic
1159153672 18:64554268-64554290 GTGGCATGGATGGACTGTGGTGG + Intergenic
1159744265 18:72211989-72212011 GCACAGGGGATGGACTGTGCTGG - Intergenic
1160114423 18:76064276-76064298 GGGCCAGGGATGGGCCGGCCTGG + Intergenic
1160607893 18:80066064-80066086 GGGCCCGGGAGTGAGTGTGCAGG + Intronic
1160982635 19:1823357-1823379 GGGTCAGGGAAGGAAGGTGCTGG + Intronic
1161021818 19:2014579-2014601 GGTCCAGGGATGGAGCGTCCTGG + Intronic
1162736854 19:12751784-12751806 GGGACAGGGATGGAATGGGCGGG - Exonic
1162952840 19:14082020-14082042 GGGCCAGGGATAGACAGGCCTGG + Intronic
1163168623 19:15515160-15515182 GTGGCCGGGCTGGACTGTGCTGG - Intronic
1163175896 19:15563972-15563994 GGGGCAGGGATGGGAGGTGCTGG - Intergenic
1163222868 19:15934486-15934508 GGGGCAAGGATGGGCAGTGCTGG + Exonic
1163649188 19:18507237-18507259 AGGCCAGGCACAGACTGTGCAGG - Intronic
1164567082 19:29333760-29333782 GGGCAGGGTCTGGACTGTGCTGG - Intergenic
1165367820 19:35380139-35380161 GGGCCAGGGAAGAAGTCTGCAGG - Intergenic
1165489654 19:36115750-36115772 GGGCCGGGGAGTGACTGGGCGGG + Intronic
1166537102 19:43581179-43581201 GGGACAGGCAGGGACAGTGCTGG - Exonic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167333246 19:48869059-48869081 GGGCCAGGGACGGTTTGTCCAGG + Intergenic
1167560758 19:50225682-50225704 GTGCCAGGGGTGGGCAGTGCTGG + Intronic
1167761215 19:51450767-51450789 GGGCTAGGGATTGACTGGGAAGG + Intergenic
1168328415 19:55550836-55550858 GGCCCAAGGATGGAGTGTGATGG - Intergenic
925805516 2:7644416-7644438 GGGCCAGGGGTGGAATGATCTGG - Intergenic
926153910 2:10440063-10440085 GGGACACGGATGGTCTCTGCAGG + Exonic
926425131 2:12732990-12733012 GGGCCAGGGTGGGGCTGAGCTGG - Intronic
926724155 2:15984475-15984497 GGGCCTTGGCTGGGCTGTGCGGG + Intergenic
927288154 2:21378467-21378489 GGGCCAGGGATGGAATGATATGG - Intergenic
927611739 2:24548436-24548458 GGGCCAGGGATGGAATGATATGG - Intronic
929617269 2:43321806-43321828 GGGCAAGGAATGGACAGTTCTGG - Intronic
931554806 2:63490746-63490768 GGGACAGGGAAGGAATTTGCTGG + Intronic
932317900 2:70798344-70798366 GGGCCAGGGATGGAATGATATGG - Intergenic
933577999 2:84092108-84092130 GGGCCAGGGATGGAATGATATGG - Intergenic
935865184 2:107380371-107380393 AGGCCAAGAATGGGCTGTGCTGG + Intergenic
936073119 2:109384431-109384453 GGTCCAGGGGTGGCCTGAGCTGG + Intronic
936096844 2:109536689-109536711 GGGCCAGGGATGGAATGATATGG + Intergenic
937459770 2:122075765-122075787 GTTCCAGGGATGGACTGAGGGGG - Intergenic
937897338 2:126987917-126987939 GGCCAGAGGATGGACTGTGCTGG + Intergenic
941560404 2:167036715-167036737 GGGCCAGGGATGGAATGATATGG + Intronic
941570154 2:167160730-167160752 GGGCCAGGGATGGAATGATATGG - Intronic
942146719 2:173034366-173034388 GGGACAGGGATCGGCTGTGCAGG + Intronic
942951653 2:181728747-181728769 GTGCAAGGGGTGGACTGTGGTGG - Intergenic
943190995 2:184679916-184679938 AGGCCAGGGAAGGCCTGAGCTGG + Intronic
943478076 2:188384502-188384524 GGGCCAGGGATGGAATGATAAGG - Intronic
946165129 2:217859026-217859048 GGGGCTGGGCTGGGCTGTGCTGG - Intronic
947749258 2:232524218-232524240 GGGCCAGGGCTGGGCTGGGCTGG - Intronic
948093733 2:235316892-235316914 GGGTAAGGGATGGAGTGTGGTGG + Intergenic
948207804 2:236171876-236171898 GGGCTCGGGAGGGACTGTTCAGG - Intergenic
948231490 2:236352205-236352227 CGGCCAGCGGTGGCCTGTGCTGG + Intronic
948630523 2:239299744-239299766 GGGCCCCAGCTGGACTGTGCTGG - Intronic
948761961 2:240197879-240197901 TGGACAGTGATGGACTGTGATGG - Intergenic
1168788841 20:562620-562642 AGGCCAGGGATGGCCAATGCCGG - Intergenic
1170117653 20:12878002-12878024 GTGGCAGGGATGGACTGGGATGG - Intergenic
1170607336 20:17883886-17883908 GGGCCAGGCAGGGAATGTTCGGG - Intergenic
1171197354 20:23210450-23210472 GGGCCAGGGCTGGAATGTTATGG + Intergenic
1171248647 20:23632773-23632795 GGCAAAGGGAAGGACTGTGCAGG + Intronic
1171290770 20:23981762-23981784 GTCCCAGGGATGGATGGTGCCGG - Intergenic
1172229438 20:33327029-33327051 GGGCCAGGGCTGGACACAGCTGG - Intergenic
1173254063 20:41380930-41380952 GGGGCAGGGAGGGATTCTGCAGG + Intergenic
1173434887 20:43023696-43023718 GGGCCAGAGCTGAACTGTGCTGG - Intronic
1173563667 20:44023769-44023791 GCAAAAGGGATGGACTGTGCTGG - Intronic
1173879341 20:46399786-46399808 GGGACAGGCATGAACTGTGCAGG + Intronic
1173880227 20:46406390-46406412 GGGCCTGGGCTGGACCGCGCCGG - Intronic
1174084066 20:47992759-47992781 TGGCCAGGGATGGAGTGAGGTGG - Intergenic
1174238585 20:49114689-49114711 GTGGCCGGGCTGGACTGTGCTGG - Exonic
1175894322 20:62329375-62329397 GGCCCAGGGCTGGGCTGGGCTGG - Intronic
1175902206 20:62364437-62364459 GGCCCAGGCAGGGACTGAGCAGG - Intronic
1175999241 20:62824744-62824766 GGGCCAGGGCTGGGCTGGGGTGG - Intronic
1176031995 20:63017238-63017260 GCGCCAGTGCTGGGCTGTGCAGG + Intergenic
1177477751 21:21645523-21645545 GGGCCAGGGATGGAATGATATGG + Intergenic
1178722838 21:35025495-35025517 TGGCCAGGGATAGCGTGTGCTGG - Intronic
1178782206 21:35614420-35614442 GGGCCAGGGATGGAATGATATGG - Intronic
1179444805 21:41423805-41423827 AGGCCAGGGAAGGACTGCGGTGG + Intronic
1180074026 21:45453677-45453699 GGGTCAGGAATGGAGTGGGCAGG + Intronic
1180159818 21:45994023-45994045 AGGCCAGGAAGGGGCTGTGCGGG + Intronic
1180581917 22:16845971-16845993 GGGGCAGGGAGGGACTCAGCAGG - Intergenic
1181006139 22:20014618-20014640 GGGCCAGGAATGGAGGGTGGGGG - Intronic
1181079590 22:20405239-20405261 GGGCCAAGGCTGGAAGGTGCAGG - Intronic
1181134968 22:20758803-20758825 AGGCCAGGGATGGGAGGTGCAGG - Intronic
1181859309 22:25805880-25805902 GGGCCAGGGAAGGCTTGTGGGGG - Intronic
1182459734 22:30475269-30475291 GTGCCAGGGATGGACTGAAAGGG - Intergenic
1182774796 22:32823186-32823208 AGGAAAGGGATGGGCTGTGCTGG - Intronic
1183025919 22:35065946-35065968 GCCCCAGGGAGGGGCTGTGCTGG - Intergenic
1183102144 22:35590782-35590804 GGGCCAGGGCTGGAGGGTGAAGG + Intergenic
1183317263 22:37143529-37143551 CGGCCAGGCATGGACTTGGCAGG + Exonic
1183415035 22:37676964-37676986 GGGCCGGGGCTTGTCTGTGCAGG + Exonic
1183484430 22:38081710-38081732 GGGCCAGGGAGGGGCTCTCCGGG - Intronic
1183489860 22:38110519-38110541 GGGCCATGGAGGGGCTGTCCCGG + Exonic
1183588542 22:38767117-38767139 AGGCCAGGGATGGCCACTGCTGG + Intronic
1184072869 22:42156958-42156980 GAGCCAGGGAGGGACTGCACTGG + Intergenic
1184089225 22:42283672-42283694 GGGCCAGGGCAGGGCTGGGCAGG - Intronic
1184426615 22:44412438-44412460 TGCCCAGGGATGGACAGTCCTGG - Intergenic
1184554484 22:45225726-45225748 GGGTCAGGGAAGGCCGGTGCTGG - Intronic
1184695278 22:46135478-46135500 GGGCCAGGCATGGGCCATGCAGG + Intergenic
1184695801 22:46138455-46138477 GGCCCGGGGGTGGGCTGTGCAGG + Intergenic
1185206247 22:49540885-49540907 GGGCCAGGAATGGCCTGGGCCGG + Intronic
950635454 3:14311292-14311314 GGGCCATGGATGGACTTCCCTGG + Intergenic
950665461 3:14492383-14492405 GTGCCTGGGATGGAGTGGGCGGG - Exonic
952537016 3:34321790-34321812 TGGCCAGGCATGGCCTGTGTTGG + Intergenic
953111091 3:39939006-39939028 TGGCCAGGGCTGGACGGTGTGGG - Intronic
954681833 3:52350132-52350154 GGGCCAGGGAGGCACAGGGCTGG + Intronic
954702315 3:52456619-52456641 GGGCCAGGGAGGGGAGGTGCAGG - Intronic
958955039 3:100458089-100458111 GGGCCAGGGATGGAATGATATGG - Intergenic
961349010 3:126287330-126287352 GAGTCAGGGATGGCCTGGGCTGG + Intergenic
961530503 3:127537293-127537315 AGGCATGGGATGGACTCTGCGGG + Intergenic
961833490 3:129637762-129637784 GGGCCAGGGATGGAATGATATGG - Intergenic
964508652 3:157425810-157425832 GGGCCAGGGATGTAATGTTATGG + Intronic
965066746 3:163858776-163858798 GGGCCAGGGGTGGAATGTTATGG + Intergenic
966124183 3:176556354-176556376 GGGCCAGGGAGAGAACGTGCTGG + Intergenic
966917573 3:184593451-184593473 GCTCCAGGGATGAACTGGGCTGG + Intronic
967577305 3:191108604-191108626 GGACCAGGGATGGAATGTTATGG + Intergenic
967892896 3:194375611-194375633 AGGTCAGGGATGGACGGGGCTGG - Intergenic
968494348 4:907211-907233 GGGGCAGTGCTGGGCTGTGCTGG - Intronic
968574341 4:1358050-1358072 GCGCCACGGAGGGACAGTGCTGG - Intronic
968671394 4:1853827-1853849 GACCCAGGGCTGGACTGTGGAGG - Intronic
968676765 4:1886244-1886266 TGGCCAGGGCTGGAGTGTGGTGG + Intronic
968902681 4:3438845-3438867 GGGCCAGGGATGGAGGGGGAGGG + Intronic
968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG + Intronic
968976453 4:3824620-3824642 GGGACAGAGATGGAATTTGCAGG - Intergenic
969128853 4:4975608-4975630 GGGCCAGGGATGGAATGATATGG + Intergenic
970099387 4:12503297-12503319 GGTCCAAGGCTGGACAGTGCAGG + Intergenic
972084173 4:35192842-35192864 TGTCCAGGGATGGACTCTGTGGG - Intergenic
972423245 4:38909882-38909904 AGTCCAGGGAGGGACTTTGCAGG + Intronic
973598635 4:52518687-52518709 AGGCCAGGGATGGACAGGGAAGG + Intergenic
975661038 4:76689401-76689423 GGGCGCGGGGTGGACTGAGCGGG + Intronic
976940129 4:90690028-90690050 GGGCCAGGTATGCACAGAGCTGG + Intronic
977072568 4:92409841-92409863 TGGCCTGGGACAGACTGTGCTGG + Intronic
977377607 4:96226700-96226722 GGGACTAGGATGGCCTGTGCTGG - Intergenic
977832370 4:101608904-101608926 GGGCCAGGGATGGAATGATATGG + Intronic
977996654 4:103503346-103503368 GGGCCAGGGATGGAATGATATGG + Intergenic
980383336 4:132056171-132056193 GAGTCAGGGATGGAGGGTGCTGG + Intergenic
981343440 4:143648411-143648433 GGGCCAGGGATGGAGTGAAATGG + Intronic
981914025 4:150014847-150014869 GGGCCAGGGATGGAATGATATGG - Intergenic
982483085 4:155934966-155934988 GGGCCAGGGATGGAATGATATGG + Intronic
982843690 4:160223725-160223747 TGGGCAGGGCTGGACTGGGCAGG + Intergenic
983048040 4:163010611-163010633 GGGCCAGGGATGGAATGATATGG - Intergenic
985769421 5:1799617-1799639 GGGCCAGGGTTGGGGGGTGCGGG - Intronic
986006405 5:3672411-3672433 GGGCCATGGCTGGAGTGTGCAGG + Intergenic
986576993 5:9222464-9222486 AGGCCAGGGAAGGAGTGTGGGGG + Intronic
986602110 5:9482742-9482764 GTGCCAGGGGTGCTCTGTGCTGG - Intronic
986679971 5:10223895-10223917 GGGCCAGGGATGGAATGCTATGG - Intergenic
986726541 5:10602179-10602201 GGCCCCGGGATGGACAGTGGTGG - Intronic
987000189 5:13652158-13652180 GGGCCAGGGATGGAATGATATGG + Intergenic
988554426 5:32224001-32224023 GGGGCAGGGGTGGACTGGGAAGG - Intergenic
988928953 5:36016512-36016534 GGGCCAGGGATGGAATGATATGG + Intergenic
990451194 5:55933186-55933208 GGGCCAGGAGAGGACTGAGCTGG + Intergenic
992111591 5:73498864-73498886 GGGCCAGGGGTGGGGGGTGCTGG + Intronic
992546577 5:77819651-77819673 GAGCCAGGCATGGACAGGGCTGG + Intronic
993164224 5:84331306-84331328 GGCCCAGGGATGGACTGATATGG + Intronic
993723863 5:91347125-91347147 GGGCCAGGGGTGGAATGATCTGG - Intergenic
994338894 5:98601657-98601679 GGGCCAGGGATGGAATGATATGG + Intergenic
995794822 5:115930147-115930169 TGGCCAGGGTTAGACCGTGCAGG + Intergenic
996238925 5:121170701-121170723 GGGCCAGGGATGGAATGCCATGG - Intergenic
996636245 5:125692790-125692812 GGGCCAGGGATGGAATGATGTGG + Intergenic
997086587 5:130806875-130806897 GGGCCAGGGATGGAATGACATGG + Intergenic
997196900 5:131986269-131986291 GGGAGAGGGAAGGACTGAGCTGG + Intronic
997211644 5:132080460-132080482 GGGCAAGGGATGGGGTGGGCAGG - Intergenic
997410720 5:133688845-133688867 GGGCCAGGGATGTCATCTGCTGG + Intergenic
998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG + Intergenic
998859488 5:146428629-146428651 GAGCCAGGGATGGAGCCTGCAGG - Intergenic
999541193 5:152573864-152573886 GGGCCAGGGATGGAATGATATGG + Intergenic
999805767 5:155079850-155079872 GGGCTGGGCATGCACTGTGCTGG + Intergenic
1000574949 5:162966034-162966056 GGGCCAGGGATGGAATGATATGG - Intergenic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1001744733 5:174083486-174083508 TGGCAAGAGGTGGACTGTGCTGG + Intronic
1002099227 5:176849075-176849097 GGGACAGGGCTGGAGTGTGGCGG + Intronic
1002177221 5:177407933-177407955 AGTCCAGGGTTGGAATGTGCTGG + Intronic
1002453003 5:179330371-179330393 GGGCCAGGGATGGCTGGTCCAGG - Intronic
1002696139 5:181092441-181092463 GGGCCAGGGGTGGGGTGAGCAGG - Intergenic
1003360410 6:5420268-5420290 GGGCCAGGGATGGAATGATATGG - Intronic
1005042903 6:21615350-21615372 GGGCCAGGGATGGGAGGTGTGGG + Intergenic
1006106338 6:31719146-31719168 GGCCCAGGGCTGGAGTGGGCCGG + Exonic
1006448169 6:34091418-34091440 GGGCCGCGGGTGGTCTGTGCTGG - Intronic
1007499750 6:42287734-42287756 TGGCCAGGGAAAGGCTGTGCAGG - Intronic
1008547991 6:52600194-52600216 AGGCCAGGGAAGGCCTGTGAGGG + Intergenic
1008910854 6:56731081-56731103 GGCCCAGGGCTGGGGTGTGCAGG + Intronic
1009396137 6:63203085-63203107 GGGCCAGGGATGGAATGTTATGG - Intergenic
1011040044 6:83019888-83019910 GAGTCAGGGAGGGACTGTGGCGG + Intronic
1012454663 6:99391003-99391025 GGGTTTGGGATGGACTGTGAAGG - Intronic
1013395925 6:109739679-109739701 GGGCCAGGGCTGGCCTGAGTGGG - Intronic
1016175561 6:141074550-141074572 TGGGCAGGGCTGGACTGGGCAGG + Intergenic
1016827764 6:148404549-148404571 GGAGCAGGGATGGGCTGGGCTGG - Intronic
1018941411 6:168310676-168310698 GGGCCAGGGCTGCAGAGTGCAGG - Intronic
1019480704 7:1265392-1265414 GCGGCAGGGACAGACTGTGCAGG + Intergenic
1019518900 7:1451859-1451881 GGGCCTGGCAAGGGCTGTGCAGG - Intronic
1019521051 7:1460607-1460629 GGGCCAGGGCTTGTCTGGGCAGG + Intergenic
1019552007 7:1607873-1607895 GGGCAAGGGTTGGGCTGGGCAGG + Intergenic
1019721859 7:2577167-2577189 GGCCCAGGGAAGCACTGAGCTGG - Intronic
1020085344 7:5307464-5307486 GGACCAGGGTGGGCCTGTGCCGG + Exonic
1022511107 7:30935404-30935426 GGGGCAGGGATGGATTGGGTGGG + Intergenic
1023254821 7:38302432-38302454 CTGGCAGGGATGGAGTGTGCAGG - Intergenic
1023905310 7:44517543-44517565 GGGCCAGCTATGGAGTTTGCAGG - Intronic
1024798577 7:53049309-53049331 GGGGCAGGGTTGGGCAGTGCTGG + Intergenic
1024976970 7:55122363-55122385 GGCCCAGGCATGGACTTTGCAGG - Intronic
1024978723 7:55137824-55137846 GGGGCAGGGATCGACTGGGAGGG + Intronic
1025208977 7:57009824-57009846 GGACCAGGGTGGGCCTGTGCCGG - Intergenic
1025662973 7:63567032-63567054 GGACCAGGGTGGGCCTGTGCCGG + Intergenic
1026020241 7:66700153-66700175 GAACCAGGGCTGGAATGTGCAGG - Intronic
1026602158 7:71785818-71785840 GGGGCAGGCATGCAGTGTGCAGG + Exonic
1026880076 7:73902259-73902281 GAACCAGGGCTGGAATGTGCAGG + Intergenic
1026937821 7:74269113-74269135 GGTTCAGGGATGCACTGCGCAGG + Intergenic
1027789554 7:82621426-82621448 GGGCCAGGGATGGAATGCTTTGG + Intergenic
1029198203 7:98821221-98821243 AGGCCAGGCATGGACTTTGAGGG + Intergenic
1029596048 7:101538107-101538129 GGGCCTGGGATGGCCAGCGCAGG - Intronic
1033800265 7:144892865-144892887 CGGGAAGGGATGGACTATGCTGG - Intergenic
1034320120 7:150172553-150172575 GGGCCAGGGATGGAATGATATGG - Intergenic
1034772625 7:153794669-153794691 GGGCCAGGGATGGAATGATATGG + Intergenic
1036576368 8:10031355-10031377 GGGCCAGGGATGGAATGCTATGG - Intergenic
1037763352 8:21756684-21756706 GTGCCAGGCAAGGACTGTGAGGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039996755 8:42541322-42541344 GGGCCAGGGCTGGTCGGCGCCGG - Intronic
1041084941 8:54247939-54247961 GGGACTGGGAAGGACTGTCCAGG - Intergenic
1041177795 8:55214688-55214710 GGCCCAGGGGTGGAGTGGGCAGG + Intronic
1041192011 8:55364314-55364336 GGCCCGGGGGTGGAATGTGCTGG - Intronic
1041708877 8:60875330-60875352 GGGCCATGGATGGGCTTTGTGGG + Intergenic
1041913527 8:63115353-63115375 GGGCCAGGAATGGACTGAGAGGG - Intergenic
1041926377 8:63241658-63241680 GGGACAGAGTTTGACTGTGCAGG + Intergenic
1041953933 8:63536696-63536718 GGGCCAGGGATGGAATGATATGG - Intergenic
1043374939 8:79638276-79638298 GAGCCAGGGATGGTTTTTGCTGG + Intronic
1043673514 8:82919569-82919591 GGGACAGGGATGGACAGTGTCGG + Intergenic
1044777541 8:95707339-95707361 GGGAAAGGGATGGACTGGGATGG - Intergenic
1044816227 8:96116164-96116186 GGGGCAGGGAGTGGCTGTGCAGG - Intergenic
1045330959 8:101155263-101155285 GGGCCAGGGAAGGAAGGGGCTGG + Intergenic
1047750784 8:127878862-127878884 TGGCCAGGGGTGGGCTGTTCTGG + Intergenic
1048553669 8:135456306-135456328 GGGGCAGGGATGGAGGGTACTGG - Intergenic
1048839477 8:138552162-138552184 GGGCCAGGGATGGAATGACACGG + Intergenic
1049023795 8:139974909-139974931 GCCCCAGGGATGGCCTGTGGAGG - Intronic
1049261245 8:141640379-141640401 GGGACAGGGAGAGACTGTGTGGG + Intergenic
1049588230 8:143441576-143441598 GGGTCAGGGCTGGGCTGGGCTGG + Intronic
1049971697 9:827109-827131 AGGCCAGGGATGGAATGTCGAGG + Intergenic
1051500316 9:17769628-17769650 GGGGCAGGAAAGGACTGTACAGG - Intronic
1051955713 9:22691006-22691028 AGGCAAGAGATGGACTGTGGGGG - Intergenic
1053179756 9:35958441-35958463 GGGCCAGGGATATGCTCTGCTGG - Intergenic
1054958482 9:70940754-70940776 GGGACAGGGATGGAGAGTGGAGG + Intronic
1057182645 9:93038181-93038203 GTGTCAGGGAGGGACTGGGCTGG + Intergenic
1057210582 9:93199004-93199026 GGGCCAGGCTGGGACTGAGCAGG - Intronic
1057271368 9:93653479-93653501 GTCCCAGGGATGGACAGTCCAGG - Intronic
1057271812 9:93655826-93655848 GGGCCGGGAAAGGCCTGTGCTGG + Intronic
1057750514 9:97788918-97788940 CAGCCTGGGAAGGACTGTGCTGG + Intergenic
1057804939 9:98213065-98213087 GGGCCAGGGATGGAGACGGCTGG + Intronic
1058834340 9:108848022-108848044 GGGCCAGGGATGGAATGATATGG - Intergenic
1060314732 9:122499138-122499160 AGGACAGGGCTGGACTGGGCAGG + Intergenic
1060536757 9:124395908-124395930 GGGCAAGGGAGGAGCTGTGCTGG - Intronic
1061036842 9:128118874-128118896 GGTACAGGGATGGAGGGTGCAGG + Intergenic
1061036864 9:128118937-128118959 GGTACAGGGATGGAGGGTGCAGG + Intergenic
1061721085 9:132551860-132551882 GGGCCCGGGAAGGAAAGTGCAGG + Intronic
1062387578 9:136319103-136319125 GGGCCAGGGAAGGGCAGAGCGGG - Intergenic
1062421098 9:136483156-136483178 GGCCGAGGGATGGGCTGTGAAGG - Intronic
1062451820 9:136618944-136618966 GGGCCAAGGAGGGAGTGTGAGGG + Intergenic
1062532855 9:137009334-137009356 GGGCCAGGGGTGGGCTGGGGCGG - Intronic
1062657982 9:137613999-137614021 GGGCCAGGGAGGGGCTTAGCAGG - Intronic
1185670933 X:1809715-1809737 AGCCCAGGGATGTGCTGTGCTGG - Intergenic
1187272825 X:17794030-17794052 GGGCCTGGGAAGGTCTGTTCAGG + Intergenic
1189666141 X:43356961-43356983 GGGCCAGGGATGAAATGTTATGG - Intergenic
1190243762 X:48677107-48677129 GGGCCAGGGTTTTCCTGTGCAGG + Intronic
1190308766 X:49101856-49101878 GGGCCAGGGTTTTCCTGTGCAGG + Intergenic
1190969940 X:55338698-55338720 GGGGCAAAGATGAACTGTGCTGG + Intergenic
1190970511 X:55343138-55343160 GGGGCAGGGAAGGAATGTGGGGG - Intergenic
1192247626 X:69386886-69386908 GGGCTAGGCATGGACTGAGAGGG + Intergenic
1192846403 X:74910638-74910660 GGGCCAGGGATGGAATGTTATGG + Intronic
1193226560 X:78990452-78990474 GGGCCAGGGATGGAATGACATGG + Intergenic
1194301801 X:92196740-92196762 CTGCCAGGGATGGAGTATGCTGG - Intronic
1194373889 X:93109459-93109481 GGGCCAGGGATGGAATGATATGG - Intergenic
1194578359 X:95641242-95641264 GGGCCAGGGATGGAATGGTATGG - Intergenic
1194906053 X:99577151-99577173 GGGCCAGGGATGGAATGATATGG + Intergenic
1195717377 X:107829708-107829730 AGGTCAGGGAGGGGCTGTGCAGG + Intronic
1195823672 X:108973478-108973500 GGGCCAGGGATGGAATGATATGG + Intergenic
1196099239 X:111830444-111830466 GGGCCAGGGATGGAATGATATGG + Intronic
1196903410 X:120409217-120409239 GGGCCAGGGGTGGAATGTTATGG - Intergenic
1197594270 X:128448422-128448444 GGGCCAGGGATGGAATGATATGG - Intergenic
1197659101 X:129150544-129150566 GGTCCAGGGATAGAATATGCAGG + Intergenic
1197729030 X:129794701-129794723 GGGCCAGGGATGGAACGGGAGGG - Exonic
1197977920 X:132184999-132185021 AGGGCAGGGATGGAGTGTGGGGG - Intergenic
1198250010 X:134870653-134870675 GGGCCAGGGATTGGCAGAGCAGG + Intergenic
1200681918 Y:6223521-6223543 GGGCCAGGGATGGAATGATATGG - Intergenic