ID: 1000946163

View in Genome Browser
Species Human (GRCh38)
Location 5:167425952-167425974
Sequence TAGGGTCAATTGAAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000946163 Original CRISPR TAGGGTCAATTGAAGGAACT GGG Intronic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
901430478 1:9211096-9211118 TAGAGTCATTTGGAGGTACTGGG + Intergenic
904789835 1:33011196-33011218 TAGGGACAATTGTAAGCACTTGG - Intronic
906006016 1:42471141-42471163 AATGGTCAAGTGAAGGAGCTTGG + Intronic
907850776 1:58252780-58252802 TGGGGTCATTTGAAGCACCTGGG - Intronic
910087877 1:83425583-83425605 GAGGGGCATTTGAAGCAACTTGG + Intergenic
917394925 1:174583177-174583199 TAGAGTCATTTGAAGGTAGTTGG + Intronic
918338042 1:183540969-183540991 TTGTGTCAATTTTAGGAACTTGG + Exonic
920601370 1:207328296-207328318 TAGGGATATTTGAAGGCACTGGG - Intronic
921104388 1:211961129-211961151 TAGGGAGAATGGAAGCAACTTGG + Intronic
1063386919 10:5621492-5621514 TAGGGTCCATTGAAAGGACAGGG + Intergenic
1066247433 10:33597067-33597089 TAGGCTCAGTTCAAGGTACTAGG - Intergenic
1066440872 10:35437216-35437238 CAGTGTCACTTGACGGAACTGGG + Intronic
1067045535 10:42983188-42983210 TAGGGTGAATGTAAGGAACCTGG - Intergenic
1067210321 10:44255514-44255536 TAGGTGCAATTGAAGTATCTAGG - Intergenic
1067238333 10:44469995-44470017 GAAGGTCATTTGAAGGACCTTGG + Intergenic
1076349743 10:129807835-129807857 TAGGGTCATTTTGAGGAACAAGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1085060097 11:73437883-73437905 GAGGGAAGATTGAAGGAACTGGG - Intronic
1090875326 11:130783945-130783967 AAGGATAAATTAAAGGAACTTGG - Intergenic
1094558715 12:31529067-31529089 TAGGGTGAATTGCTTGAACTCGG + Intronic
1094748786 12:33380389-33380411 TAGAGTCAATTAAAGAAAATTGG - Intronic
1095415199 12:41969067-41969089 TAGGGTAAATTTAAAGAAGTGGG - Intergenic
1103476433 12:121222248-121222270 CAGGGTCATGTGAAGGAATTGGG - Intronic
1103687378 12:122742806-122742828 AAGGGTGAATTGAAAGAACTTGG + Intergenic
1103821598 12:123702996-123703018 CAAGGTCAATTGGAGGAAGTAGG - Intronic
1105893781 13:24701154-24701176 TATGGTCACTTCAAGGCACTAGG - Intronic
1106259675 13:28055332-28055354 TAGGAGCAGTTGAAGGAATTGGG - Intronic
1110345089 13:74437808-74437830 TAGGAACTATTGAAGTAACTTGG + Intergenic
1110452470 13:75652172-75652194 AAGGGAAAATTAAAGGAACTTGG - Intronic
1115330521 14:32192049-32192071 TACGTCCAATTCAAGGAACTGGG + Intergenic
1116546608 14:46174952-46174974 TGAGGTCATTTGAAAGAACTGGG + Intergenic
1117638907 14:57776192-57776214 TGGGGTGAATGGAAGCAACTTGG + Intronic
1120679012 14:87457028-87457050 TAGGGTACATTGCAGGCACTTGG - Intergenic
1123781031 15:23628769-23628791 TAGGGTAAACAGAAGTAACTGGG - Intronic
1123906612 15:24927670-24927692 TTGGGGCAAATGAAGAAACTGGG - Intronic
1127395236 15:58539328-58539350 TATGGTCAATGGATGTAACTGGG - Intronic
1127579891 15:60328457-60328479 TAGGGGCAATTGAGGCAAATTGG - Intergenic
1131391094 15:92049431-92049453 TAGGGTCAGTTGCAAGAGCTTGG - Intronic
1132164152 15:99568070-99568092 TAGTGTGAATTAAAGGAAATAGG - Intronic
1132235052 15:100213675-100213697 TAGGATGAATAGAAGGATCTAGG - Intronic
1132337797 15:101059906-101059928 GAGGGTGAATTGGAGGACCTTGG + Intronic
1132526209 16:416459-416481 TGCGGTCACTGGAAGGAACTCGG - Intergenic
1134503166 16:14784859-14784881 TAGGGACCCTTGAAAGAACTGGG + Intronic
1134577399 16:15344039-15344061 TAGGGACCCTTGAAAGAACTGGG - Intergenic
1134725047 16:16412470-16412492 TAGGGACCCTTGAAAGAACTGGG + Intergenic
1134942385 16:18299388-18299410 TAGGGACCCTTGAAAGAACTGGG - Intergenic
1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG + Intergenic
1140947367 16:79782002-79782024 TAGTGGCAAATGGAGGAACTAGG - Intergenic
1141267106 16:82507372-82507394 AAGGGCCATTTGAAGGGACTGGG - Intergenic
1147218429 17:38914257-38914279 GAGGGTCACGGGAAGGAACTGGG + Intronic
1147917425 17:43897007-43897029 TAGGGTAAACTGGTGGAACTTGG - Intronic
1149017754 17:51928441-51928463 TGGGCTCAAATGAAGGAACAAGG - Intronic
1149138815 17:53404499-53404521 TAGTGTCAATTACAGTAACTTGG + Intergenic
1151879765 17:76887947-76887969 TGGGGCCAATGGAAGGACCTGGG - Intronic
1153497533 18:5715263-5715285 TAATGTCATTTGCAGGAACTTGG + Intergenic
1159136965 18:64347831-64347853 TAGGGCCCTTTGAAGGACCTGGG + Intergenic
1159331917 18:67005799-67005821 TCCGGTCATTTGCAGGAACTTGG - Intergenic
1160076088 18:75679227-75679249 TGGGGTCACCTGAAGGAACAGGG - Intergenic
1165357599 19:35313442-35313464 CCGGGTCAAGTGAAGGAGCTGGG + Exonic
944892337 2:204130505-204130527 TGGGGCCAATGGAAGGAACATGG - Intergenic
946661130 2:222000649-222000671 TTGGGTAAATTTAAGGTACTTGG + Intergenic
1169411757 20:5376865-5376887 TGGTGTCAACTGAAGCAACTGGG - Intergenic
1174496164 20:50944593-50944615 GAGGGACAAGGGAAGGAACTTGG + Intronic
1174984913 20:55440281-55440303 TAGGGTGAAGAGGAGGAACTGGG + Intergenic
1183030733 22:35102626-35102648 CAGGGTCACATGAAGGAACCTGG + Intergenic
950160046 3:10753550-10753572 TGGGGTCAATTGTAGGAAATGGG + Intergenic
950279937 3:11698179-11698201 TAGGGTAAATTGATGAAAATGGG - Intronic
950551558 3:13669260-13669282 GAGGGGCAATTGGAGGAGCTGGG + Intergenic
954989803 3:54830837-54830859 TAGGGTAAATTGCAGGCACGAGG - Intronic
958760284 3:98297875-98297897 TATGGGTATTTGAAGGAACTTGG - Intergenic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
973331692 4:48915714-48915736 TAGGGTCAAGTGAAGGGATCTGG - Intergenic
973685974 4:53370362-53370384 TAGGGTCAAAGAAAGTAACTTGG + Intergenic
974128683 4:57727556-57727578 TAGGGACAAGTAAAGGTACTGGG - Intergenic
977495132 4:97765785-97765807 TAGGAATAGTTGAAGGAACTGGG + Intronic
977860652 4:101955814-101955836 TATGGCTAATTGATGGAACTTGG - Intronic
978448846 4:108807076-108807098 GAGGCAGAATTGAAGGAACTTGG + Intergenic
978596338 4:110380982-110381004 TAGGGACAATAGAAACAACTTGG + Intronic
978843931 4:113249475-113249497 GAGGGTCAATGGAATGAAATTGG - Intronic
982866824 4:160523780-160523802 TAGGATAAATTGAAGGAATGTGG - Intergenic
985001017 4:185483052-185483074 TAGGGTCAAATGAAACAACATGG - Intergenic
987110626 5:14682914-14682936 TGGGAGCCATTGAAGGAACTGGG + Intronic
989140393 5:38195909-38195931 TAGGGGCAGTGGAAGGAAATTGG - Intergenic
992135578 5:73740653-73740675 GAAGAACAATTGAAGGAACTGGG - Intronic
999855887 5:155593289-155593311 TAGGGCCAACTGCAGGTACTAGG + Intergenic
1000946163 5:167425952-167425974 TAGGGTCAATTGAAGGAACTGGG + Intronic
1001205425 5:169757918-169757940 AATGGTCAATTAAAGGAAATTGG + Intronic
1001551834 5:172608394-172608416 TTTGGTCAAATGAAGGCACTGGG + Intergenic
1006779229 6:36620817-36620839 GAGGGTCAGGTGAAGGAAGTTGG + Intergenic
1008354508 6:50535388-50535410 CAGGGTCAAGTGGAGGATCTTGG - Intergenic
1010666630 6:78638353-78638375 CATGGTCAATTGTAGCAACTGGG - Intergenic
1012020723 6:93915629-93915651 TAGGGAGAATTAATGGAACTGGG - Intergenic
1016619063 6:146086688-146086710 AAGGGTCAATTGTTGGTACTGGG - Intronic
1018524716 6:164696142-164696164 GAGGGTCAACTGTAAGAACTCGG + Intergenic
1019067323 6:169313259-169313281 GAGGCTCAATTTAAGGAATTTGG + Intergenic
1026805390 7:73426316-73426338 TAGAGAGAATTGAAGCAACTTGG - Intergenic
1027304758 7:76882057-76882079 GAGGGGCATTTGAAGCAACTTGG + Intergenic
1030764931 7:113396997-113397019 TTGGGGAAATTGAAGAAACTTGG + Intergenic
1033279796 7:139997715-139997737 TAGAGTAAATAGAAGAAACTAGG + Intronic
1037000901 8:13717570-13717592 TAGGGGGAATTGATGGAAATAGG + Intergenic
1043576225 8:81660744-81660766 AAGTGTCGATTGAAGAAACTTGG + Intronic
1043784222 8:84376878-84376900 TAGGGTAAATTGACTAAACTTGG - Intronic
1044513023 8:93105934-93105956 TAGAGTTATCTGAAGGAACTAGG + Intergenic
1050237470 9:3596934-3596956 TACGGACAATTGAAGAAAGTGGG - Intergenic
1050735811 9:8761740-8761762 TAGGGTCTATTAAAGAAAATGGG + Intronic
1051903511 9:22068432-22068454 TAGGGGAAATTGAAGGATCAGGG + Intergenic
1054988871 9:71297750-71297772 CTGGGGCAACTGAAGGAACTTGG - Intronic
1061348896 9:130048367-130048389 TAGTCTGAAATGAAGGAACTGGG + Intergenic
1185669549 X:1795688-1795710 TAGAGGCAATTGAAGGTATTTGG - Intergenic
1185952872 X:4455792-4455814 TAAGGTAAATTGAAGTCACTAGG - Intergenic
1186032320 X:5381544-5381566 TAGTGTCAATTTAAGGTAATTGG + Intergenic
1188485229 X:30675024-30675046 TGGGGTCAGTTGAAGGAAATTGG + Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1188784213 X:34324312-34324334 TAGTGTCATTTGCAGCAACTTGG + Intergenic
1189288306 X:39867500-39867522 CAGGGACAGTTGAAGGGACTGGG - Intergenic
1197598311 X:128494404-128494426 CATGGTCAATTGAGGGAAATTGG - Intergenic
1198032925 X:132771587-132771609 TAGGCTCAAAAGAAGGAAATGGG + Intronic