ID: 1000948143

View in Genome Browser
Species Human (GRCh38)
Location 5:167447643-167447665
Sequence CACATGGAACTGCTTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000948136_1000948143 8 Left 1000948136 5:167447612-167447634 CCTGAAGAGTAACACCTGACCCC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1000948143 5:167447643-167447665 CACATGGAACTGCTTCCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 184
1000948137_1000948143 -6 Left 1000948137 5:167447626-167447648 CCTGACCCCATTCATACCACATG 0: 1
1: 0
2: 1
3: 7
4: 131
Right 1000948143 5:167447643-167447665 CACATGGAACTGCTTCCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 184
1000948135_1000948143 27 Left 1000948135 5:167447593-167447615 CCAAGGAGTGCTTTGCAAACCTG 0: 1
1: 0
2: 3
3: 14
4: 179
Right 1000948143 5:167447643-167447665 CACATGGAACTGCTTCCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000948143 Original CRISPR CACATGGAACTGCTTCCCCC TGG Intronic
900158362 1:1212423-1212445 CACAGGGAAAGGCTGCCCCCAGG + Intronic
900372346 1:2337547-2337569 CAGATGGAGCTGCAGCCCCCAGG + Intronic
900596469 1:3482329-3482351 TACACGAAACTGCTGCCCCCTGG - Intergenic
904809862 1:33156466-33156488 CTCCTGGAAATGCTTCCTCCAGG + Intronic
905520315 1:38593984-38594006 CACATGGGTCAGCTTCCCCAAGG + Intergenic
905742379 1:40383390-40383412 CACAGGGAACTACATCTCCCAGG - Intronic
909214109 1:72863679-72863701 CACTTGCACCTGATTCCCCCTGG + Intergenic
912961166 1:114197057-114197079 CATATGGAACTGCAACCCCTAGG - Intergenic
913200168 1:116489520-116489542 CACATGGGACTGCTTGCCAGGGG + Intergenic
915586049 1:156844548-156844570 CACCTGGCCCTGCTGCCCCCTGG - Exonic
918045169 1:180936910-180936932 CCCATGGTTCTGCCTCCCCCGGG - Intronic
920494070 1:206441745-206441767 CACAGGGAATTGCTGCCACCAGG - Intronic
920977402 1:210798759-210798781 TAAATTTAACTGCTTCCCCCTGG - Intronic
923068182 1:230539173-230539195 CACAGGAAACAGCTTCACCCAGG + Intergenic
1063385493 10:5613835-5613857 CACAAGGCACTCCTTCCCCTAGG + Intergenic
1065379524 10:25075762-25075784 CACATTGAATGGCTTCCCCGAGG - Intergenic
1067067847 10:43113617-43113639 CACCTGCAACTGCTTCCCTGAGG + Exonic
1070521982 10:77261826-77261848 CAGATGGAACTTTTTCCCCTAGG - Intronic
1074300858 10:112232315-112232337 CACATTGAATTACTTGCCCCAGG - Intergenic
1076488939 10:130843391-130843413 CACTTGGTACAGATTCCCCCAGG - Intergenic
1077922514 11:6652336-6652358 CAAATGTAACTGCTTTCCCTAGG - Intronic
1079520507 11:21320972-21320994 CACATGTAACAGCTTCCTCCAGG - Intronic
1080450913 11:32378245-32378267 TACATGGAACTGGTTTCCACTGG - Intergenic
1080471826 11:32553221-32553243 CACATGGAACAGCTATACCCTGG - Intergenic
1081415701 11:42812518-42812540 CAGATGGAGCTGTTTCCCCAGGG - Intergenic
1081546523 11:44075747-44075769 CCCCTGGAACTGCTGACCCCCGG - Intronic
1082004113 11:47410292-47410314 CACCTGGATCTGCTCCCTCCTGG + Exonic
1082789698 11:57338774-57338796 CAGAAGAAACTGTTTCCCCCAGG - Intronic
1083322045 11:61853920-61853942 CACATGGCCCGGCATCCCCCAGG + Intronic
1084013833 11:66367384-66367406 CAGATGGAACAGCTTCCCAGGGG + Intronic
1087039456 11:93784554-93784576 CTCATGGACCTGCTTCTCGCAGG - Exonic
1088452296 11:109995088-109995110 CACAGACCACTGCTTCCCCCTGG + Intergenic
1088969397 11:114759326-114759348 GACATGAAACAGCTTCCCCACGG - Intergenic
1089400871 11:118163911-118163933 CTCATAGAGCTGCCTCCCCCAGG - Exonic
1089460816 11:118652343-118652365 AAAATGGAACTCCTTTCCCCAGG - Intronic
1092270644 12:7020579-7020601 CACATGAAACTCCATCTCCCGGG - Intronic
1092503081 12:9066374-9066396 CACAACAAACAGCTTCCCCCTGG - Intergenic
1093219677 12:16404826-16404848 CAGATGGAATTGCTTTCCTCTGG + Intronic
1096538187 12:52288541-52288563 CACCAGGGACTGCTTTCCCCTGG - Intronic
1097915880 12:65019820-65019842 GAGAAGGAACTGCTTTCCCCTGG + Intergenic
1099370582 12:81825053-81825075 GACATAGAACTCCTTCCCTCTGG + Intergenic
1101800241 12:108015712-108015734 GAAATGGAACTGCTTTTCCCTGG + Intergenic
1102960810 12:117092288-117092310 CACATGGAACGCCATCCTCCAGG + Intronic
1103076259 12:117985294-117985316 TACATGTAACTGCTGCCGCCTGG + Intergenic
1104742526 12:131188848-131188870 CACCTGGAACTGATTACACCTGG - Intergenic
1104816507 12:131649111-131649133 CACAAGTGACTGCTTCCCCTTGG + Intergenic
1105665177 13:22547559-22547581 CACATTCCACTGCTTCCTCCAGG + Intergenic
1107192166 13:37602209-37602231 GACATGGAAGTGCTACCCCCAGG - Intergenic
1112174738 13:97010833-97010855 CACATGGGAGTCCTTCTCCCAGG + Intergenic
1112329797 13:98468617-98468639 CACATCTGTCTGCTTCCCCCAGG + Intronic
1112486751 13:99827180-99827202 CACTGGGAACTGCTTCCAACTGG - Intronic
1113389526 13:109882190-109882212 CACAGGAATCTGCTGCCCCCAGG - Intergenic
1114542751 14:23474499-23474521 CACAAGTAACTGCTACCCCTAGG - Intronic
1118075846 14:62298014-62298036 CACATGGAATTGCTTCATCTTGG + Intergenic
1119434915 14:74592250-74592272 CGCATGGAACTGCCTCTCCTGGG - Intronic
1120267489 14:82269722-82269744 CACAAGGACCAGCTTCCCACAGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1127340891 15:58042816-58042838 CACAAGGAACTGCTTTTCTCTGG + Intronic
1127508354 15:59616222-59616244 CAAATGCAACTGCTCCCTCCCGG - Intronic
1127873364 15:63091261-63091283 CCTATTAAACTGCTTCCCCCAGG - Intergenic
1129734676 15:77952869-77952891 AACGTGGAACTGGTTCCACCTGG + Intergenic
1129840914 15:78743122-78743144 AACGTGGAACTGGTTCCACCTGG - Intergenic
1130017072 15:80195874-80195896 CAAGAGGAACTGCTTCCACCAGG + Intergenic
1134507972 16:14823488-14823510 ATCAGGGAACTGCCTCCCCCAGG + Intronic
1135055965 16:19232328-19232350 CACATGCATCTGCGTCGCCCAGG + Intronic
1135679329 16:24443305-24443327 CACATGGATGTGATTCCCTCTGG - Intergenic
1138190421 16:55009620-55009642 CACATGGATTTCCTTCTCCCAGG - Intergenic
1141444641 16:84050050-84050072 CACATGGATCCGGTTCCTCCCGG + Intergenic
1141603023 16:85137620-85137642 CACATGGGGCAGCTTCGCCCGGG - Intergenic
1142154509 16:88527029-88527051 CACAGGGAGCTGCTGGCCCCGGG + Intronic
1144685492 17:17223391-17223413 CATATGAAAATGCTTCCCCTAGG - Intronic
1144761474 17:17709858-17709880 CTCTTGGAACTGCCTCCTCCTGG - Intronic
1145102776 17:20090434-20090456 CACATGCAACTGCCTCTGCCTGG - Intronic
1145908109 17:28527374-28527396 CAAGTGGGCCTGCTTCCCCCAGG + Intronic
1146827248 17:36033458-36033480 TACTGGGAACTGCTTCCACCTGG + Intergenic
1147664533 17:42138260-42138282 CCTATGGAACTGCTTCACACAGG + Intronic
1148837225 17:50471735-50471757 CACAAGCAGCTGCTTCCCCTGGG + Intronic
1149634357 17:58154978-58155000 CATATGGAACTTCCTCCCCGTGG + Intergenic
1152520875 17:80855899-80855921 CTCGTGGTGCTGCTTCCCCCAGG + Intronic
1153138569 18:1945759-1945781 CACATGAGACTGCTTCCCATGGG - Intergenic
1153510532 18:5846954-5846976 CACCTGCAACTCTTTCCCCCAGG - Intergenic
1154341166 18:13503589-13503611 CACATGGGGCTGCTTTCCACTGG - Intronic
1155547443 18:26929951-26929973 CACATGGCAATGCTGCTCCCAGG - Intronic
1156297903 18:35809248-35809270 CACAGGGAACTGCATTTCCCAGG - Intergenic
1156510864 18:37635343-37635365 CCCATAGAACTGCTTCTCTCAGG - Intergenic
1157648590 18:49303651-49303673 CACATGACAGTGCTTCCCACAGG + Intronic
1160923515 19:1531858-1531880 CACATGGCCCTGCGACCCCCCGG + Exonic
1161801969 19:6421366-6421388 CACTTGGCACTGCCTGCCCCGGG + Intronic
1164597390 19:29539241-29539263 GACATGGAGCAGCTTTCCCCAGG - Intronic
1164897697 19:31891423-31891445 CAAATGGAGCTGCTTCTGCCGGG + Intergenic
1165214585 19:34261441-34261463 CCCATGGAACTGCTTGCTTCTGG + Intronic
929546363 2:42857400-42857422 CACATGCCACTGTTTGCCCCTGG - Intergenic
933349579 2:81136710-81136732 CACATGGACCTGCCTGACCCAGG + Intergenic
933632683 2:84674838-84674860 CACATGGAAATGCCTCTCCCTGG + Intronic
936138703 2:109919618-109919640 CACATGCCACTGCTTGCCCATGG - Intergenic
936205993 2:110451867-110451889 CACATGCCACTGCTTGCCCATGG + Exonic
938935701 2:136125825-136125847 TACATGGAAATGCTTTCTCCAGG - Intergenic
941285104 2:163601770-163601792 CACATAGAACTGTTACCCTCAGG - Intronic
942013524 2:171788695-171788717 CAAATTGAATTTCTTCCCCCGGG - Intronic
943197719 2:184776729-184776751 CACATGGAACTAGTACCCCAGGG + Intronic
944119793 2:196228650-196228672 CATATGTAACTGATTCCCCCTGG - Intronic
946495379 2:220191260-220191282 CACAGGGAACTGCTTGCCACAGG - Intergenic
947544437 2:231001086-231001108 CACAGGGAACATCTGCCCCCAGG + Intronic
948177410 2:235954942-235954964 CACATGGCACTGCCTCCCCTTGG + Intronic
948384080 2:237570945-237570967 TACATGGACCAGCTTCTCCCAGG + Intergenic
1170765849 20:19289654-19289676 CACATAGTGCTGCTTCCTCCTGG + Intronic
1171053446 20:21883218-21883240 CCCAAAGCACTGCTTCCCCCAGG - Intergenic
1172005486 20:31816531-31816553 CTCATGAAGCTGCTTACCCCAGG + Intergenic
1173925015 20:46774487-46774509 CCCATTCACCTGCTTCCCCCTGG - Intergenic
1174773826 20:53325403-53325425 CACATGCAGCTTCTTCCCCAGGG - Intronic
1180594501 22:16964425-16964447 CACATGTACATGCTTCACCCTGG - Intronic
1181386602 22:22550532-22550554 AACATGCACCTGCTTCCTCCTGG - Intronic
1181853252 22:25765031-25765053 CTCATGGAACCCTTTCCCCCAGG - Intronic
1182509303 22:30807620-30807642 CACATGGTACTCTTTCTCCCTGG + Intronic
1185020685 22:48372981-48373003 CGCCACGAACTGCTTCCCCCAGG + Intergenic
1185167626 22:49271347-49271369 CACCTGGCTCTGCTGCCCCCAGG + Intergenic
950191923 3:10982786-10982808 CACATGTAACTGCCTCCCAGAGG + Intergenic
955439933 3:58944520-58944542 CAAATGAAACTGCTTCAGCCTGG - Intronic
962421952 3:135236833-135236855 CACATAGAAGTGCTACCCTCTGG + Intronic
962493391 3:135915755-135915777 CACCTGGAACTGCCTACCTCTGG + Intergenic
962942169 3:140134960-140134982 CACATGGAATTCCTTGCCCCAGG + Intronic
965678731 3:171228760-171228782 CATTAGGAACTGCTTCCCCAAGG + Intronic
966162570 3:176983753-176983775 CCCAAGAAACTGCTTCTCCCTGG - Intergenic
966465645 3:180228302-180228324 CACATGGGCCTGGGTCCCCCCGG - Intergenic
968383199 4:112288-112310 CACCTGGAAGTGCTTTGCCCTGG + Intergenic
970254540 4:14153972-14153994 CAAAAGGCACTGCTTCCTCCAGG - Intergenic
971008714 4:22405699-22405721 CACAGGGCACTGCTTCCACAGGG + Intronic
971027903 4:22606675-22606697 CACATGGCAATGCTGCTCCCAGG - Intergenic
971054390 4:22896365-22896387 CACATGGCACTCCTCCCCTCCGG + Intergenic
972300073 4:37776898-37776920 AACATGGAACTGCTTCTTCAAGG - Intergenic
972771119 4:42197879-42197901 CAAATGCAACTGCTTCAACCTGG - Intergenic
972831378 4:42817759-42817781 CACATGAAAATGCTTTCTCCTGG - Intergenic
976147245 4:82054029-82054051 CACATGGCACTGATTCTGCCTGG + Intergenic
982115829 4:152097727-152097749 AAAAGGGACCTGCTTCCCCCTGG - Intergenic
985705096 5:1395804-1395826 GACAGAGAACTGCTTCACCCTGG - Intronic
985765488 5:1777299-1777321 CACATGGAGCTGTCTCCTCCAGG + Intergenic
987349155 5:17006205-17006227 CACATGGAACCCCTCACCCCTGG - Intergenic
995245521 5:109931046-109931068 CACATGATGCTGCTTCCCTCAGG + Intergenic
998389453 5:141778260-141778282 CACGTGCATCTGCTTCACCCTGG - Intergenic
999802226 5:155048832-155048854 CATATGTAACTCGTTCCCCCTGG - Intergenic
1000118161 5:158172759-158172781 CACATGGAGCTTTTTCCTCCAGG + Intergenic
1000948143 5:167447643-167447665 CACATGGAACTGCTTCCCCCTGG + Intronic
1002518422 5:179775941-179775963 CAAGTGGAATTGCTTCCTCCGGG - Exonic
1002634990 5:180602893-180602915 CCCATGGAAGTGCTGGCCCCGGG + Exonic
1004148078 6:13088834-13088856 CACATGGAAATATTTCCTCCTGG + Intronic
1006784641 6:36657835-36657857 CTACTGGAACTGCTTCACCCAGG + Intergenic
1007235457 6:40388064-40388086 CAGAAGGAACTGCTTCACCAAGG + Intergenic
1008389691 6:50935581-50935603 CACATGGAACTCCTTCCTTCTGG - Intergenic
1011524630 6:88251058-88251080 CACAGAGAACTCCTTCACCCAGG - Intergenic
1019480640 7:1265172-1265194 CACAGGGAGCTGCTTCGGCCAGG + Intergenic
1021658946 7:22899083-22899105 GACATGGCACTGCTTCCCAGGGG + Intergenic
1023904684 7:44513749-44513771 CACATGGCACAGATCCCCCCTGG - Intronic
1024544300 7:50504122-50504144 CACAAGCAACTGCTGCCCCATGG + Intronic
1027486713 7:78770728-78770750 AATATGGCACTGCTTTCCCCAGG + Intronic
1027883829 7:83876804-83876826 CCCAGGGAACAGATTCCCCCAGG + Intergenic
1029149400 7:98469436-98469458 CAGAAGGAACTGCTTCCTCGTGG + Intergenic
1029459209 7:100685808-100685830 GACATGGCTCTGCTACCCCCTGG + Intronic
1029701866 7:102252440-102252462 TATATGGAACCGTTTCCCCCAGG - Exonic
1033652631 7:143354207-143354229 TACATGAACCTGCTTTCCCCAGG - Exonic
1034074728 7:148220882-148220904 CACATGGACCAGCCTCCCACTGG + Intronic
1034537001 7:151731627-151731649 AGCATGGAGCTGCTTCCCCAGGG - Intronic
1036469571 8:9040421-9040443 CACTTGGCACTGCTGCCCCAAGG - Intronic
1039258928 8:35749652-35749674 CCCATGGAACTTCATGCCCCAGG - Intronic
1039538484 8:38341619-38341641 CACATGCTACTCCTTCCTCCTGG - Intronic
1040415304 8:47189541-47189563 CAGTTGGAGCTGCTTCCCCGGGG - Intergenic
1041042190 8:53858680-53858702 CACATGATACTGATTCACCCTGG + Intronic
1041346775 8:56907274-56907296 CCCAGGGGACTGCTTCCCTCAGG - Intergenic
1041477214 8:58279803-58279825 CACAGGAAACTGCTACCCTCTGG - Intergenic
1042028565 8:64449425-64449447 AACAAGGGTCTGCTTCCCCCTGG - Intergenic
1043106496 8:76119374-76119396 CACATGGAACTGTTCCCCAGAGG + Intergenic
1044986904 8:97763864-97763886 CACAAGGAACTGCTTCCCGGAGG - Intergenic
1047138018 8:122103470-122103492 TCCAGGGAACTGCTTCCCCTAGG + Intergenic
1048784043 8:138031707-138031729 CAAATGGCTTTGCTTCCCCCTGG - Intergenic
1049692083 8:143965884-143965906 CCCAGGGAACTCCTTCCCCAGGG + Intronic
1051768648 9:20551432-20551454 TACATGGACCTGCTTTCCCTGGG + Intronic
1052903622 9:33816567-33816589 CACGTGGAACTGCCGCACCCAGG + Intergenic
1055468208 9:76586183-76586205 CAGGTGGAATTGCGTCCCCCAGG - Intergenic
1057481170 9:95446913-95446935 CAGTTGGAGCTGCTTCCCCGGGG + Exonic
1058969731 9:110069807-110069829 CACATGCACCGGCTTCCGCCTGG + Intronic
1061247324 9:129407267-129407289 CACATCCTCCTGCTTCCCCCTGG - Intergenic
1061276019 9:129569686-129569708 CACAAGGAAGTGCTCCCCACAGG + Intergenic
1061300075 9:129699062-129699084 CACAGGGAAATGCTTCAGCCTGG - Intronic
1062135117 9:134922714-134922736 CAGAGGGAATTCCTTCCCCCTGG + Intergenic
1062210394 9:135360448-135360470 CACATGGCTCTGCTTCCTTCTGG - Intergenic
1185802888 X:3029433-3029455 CACATGGTGCAGCTTCCGCCAGG - Intronic
1186239027 X:7546635-7546657 CACATGGGACGGCTGCCCTCTGG - Intergenic
1189500957 X:41558133-41558155 CACCTGCATCTGCATCCCCCAGG - Intronic
1189673616 X:43438577-43438599 CACATTGAACTACTTGCCCAAGG - Intergenic
1190125206 X:47698650-47698672 CACATGGAGCTTGTTCCTCCTGG + Intergenic
1194290379 X:92064751-92064773 CTCATTAAACTGCCTCCCCCGGG - Intronic
1194443742 X:93962664-93962686 CAGAGGGAACTGCTGCCACCAGG + Intergenic
1195654801 X:107324108-107324130 CACCTGGGACTGCCTCCCCAGGG + Intergenic
1199582979 X:149379016-149379038 AACAGGGAACTGCTTCACACTGG - Intergenic
1201458258 Y:14194534-14194556 CACATGGGACAGCTGCCCTCTGG - Intergenic