ID: 1000948277

View in Genome Browser
Species Human (GRCh38)
Location 5:167449129-167449151
Sequence ATGTAAAAGCTAAAGCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000948275_1000948277 7 Left 1000948275 5:167449099-167449121 CCAAATAAAATTGTAATGTGGCC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1000948277 5:167449129-167449151 ATGTAAAAGCTAAAGCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000948277 Original CRISPR ATGTAAAAGCTAAAGCTTGT AGG Intronic
No off target data available for this crispr