ID: 1000950239

View in Genome Browser
Species Human (GRCh38)
Location 5:167472857-167472879
Sequence GGAAGCCAAAAGACCTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000950236_1000950239 -1 Left 1000950236 5:167472835-167472857 CCACATGGACTCATACACTTCAG 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1000950239 5:167472857-167472879 GGAAGCCAAAAGACCTAGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000950239 Original CRISPR GGAAGCCAAAAGACCTAGCT GGG Intronic
900474035 1:2868049-2868071 GGGGGCCACAAGCCCTAGCTTGG - Intergenic
900684713 1:3940774-3940796 AGAAGCCACATAACCTAGCTAGG + Intergenic
901311295 1:8271292-8271314 GGAAGCCCAGAGAACTTGCTGGG - Intergenic
901550540 1:9992967-9992989 GGAAGCCAAAGGAGCTAACCAGG + Intergenic
902091392 1:13906562-13906584 GGAAGCCAAGAGACAAAGTTAGG - Intergenic
902381508 1:16054907-16054929 GAAAGCAAAAACACCAAGCTGGG + Intronic
903698581 1:25229030-25229052 GGAAGCCAAAAAAGCTCGTTTGG - Exonic
913141560 1:115946409-115946431 GGAAACCAGATGACCCAGCTTGG - Intergenic
916042805 1:160975853-160975875 GGAAACCAGAAGACCCAGCCAGG - Intergenic
922796117 1:228340657-228340679 GGAACCCAAGAGACCCAGCCTGG - Intronic
1064253417 10:13724443-13724465 GGAAGACAGAAGACTTTGCTAGG - Intronic
1065062595 10:21920549-21920571 GAAAGCCCAAATATCTAGCTGGG - Intronic
1065197586 10:23281624-23281646 GAATGCCAAAATATCTAGCTGGG + Intronic
1067521490 10:47010268-47010290 GGAAGGCAAAAGAGCTGGGTTGG + Intergenic
1069925192 10:71845281-71845303 GGAAGGAAAAAGACCTAACGGGG + Intronic
1070253245 10:74791568-74791590 AGAAGACACAAGACCTGGCTGGG + Intergenic
1072907383 10:99467021-99467043 GGAACCCAACAGACATCGCTGGG + Intergenic
1072924993 10:99609361-99609383 GGAAGGCAAATGAGCTAACTTGG - Intergenic
1074599589 10:114900240-114900262 GGACTCCAATTGACCTAGCTTGG - Intergenic
1074860119 10:117503596-117503618 GGAAGCCAAAATGCCAAACTAGG - Intergenic
1075816940 10:125271716-125271738 GGAAGCCTGGAGACCTGGCTTGG + Intergenic
1077714204 11:4565312-4565334 GGAAGGCATAAAACCTAGATGGG + Intergenic
1078656248 11:13243156-13243178 GGAGTCCAAGAGACCTGGCTGGG + Intergenic
1080780012 11:35420468-35420490 GGAACCCAAAAGAACTCACTTGG + Intergenic
1086363009 11:86078652-86078674 GGAAGTCAAAAGAAGTAGATAGG + Intergenic
1086775262 11:90823167-90823189 GGAAGCCAAAATGCGTTGCTAGG - Intergenic
1086948807 11:92870281-92870303 GGAAGCCACAATTACTAGCTTGG + Intronic
1087584856 11:100105782-100105804 GGAAACCTGAAGACCTGGCTGGG - Intronic
1089271607 11:117305434-117305456 GGAAGGCAGAGGAACTAGCTGGG - Intronic
1089393518 11:118118102-118118124 GGAAGTCAGCAGCCCTAGCTCGG + Exonic
1089683862 11:120134571-120134593 GGAAGCCAGGAGACTGAGCTGGG - Intronic
1091055185 11:132411210-132411232 GGAAGCGGAAGGACCTAGCCAGG - Intergenic
1092045448 12:5429488-5429510 GGAAGCCACAACAGCGAGCTGGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1097294710 12:57950018-57950040 GGAAGCCAAAAGAGTTATTTAGG - Intronic
1099011518 12:77296979-77297001 TGAAGCCAAAAGACTTGGCTTGG + Intergenic
1101574385 12:105983952-105983974 GGGGGACAAAAGACCTTGCTGGG + Intergenic
1101864948 12:108514023-108514045 GGAAGCCAAAAGAACTAGCCAGG + Intergenic
1104537286 12:129629808-129629830 GGCTGCCACATGACCTAGCTTGG + Intronic
1108957366 13:56176964-56176986 GGAAGTCAAAAGACAAAGTTGGG - Intergenic
1109305825 13:60640529-60640551 GGAGGACAAGAGACCAAGCTTGG - Intergenic
1110753992 13:79149713-79149735 GGCAGCCAGCAGAACTAGCTGGG + Intergenic
1112900823 13:104354677-104354699 GGAGGCCAGAAGACTTAGCCAGG + Intergenic
1113362608 13:109645151-109645173 GGAAGCTAAAAGACCCAGCCGGG - Intergenic
1113563728 13:111304681-111304703 GGAAGCCAAAGGGGCTTGCTGGG - Intronic
1116991862 14:51285552-51285574 GGGAGCCAAAAGACCCTGCATGG + Intergenic
1117975517 14:61292796-61292818 GCAAGCCACAACACCCAGCTTGG - Intronic
1118108597 14:62690191-62690213 GTAAGCCAAAAGACTTGGTTTGG + Intergenic
1119568218 14:75646760-75646782 GGAAGGCAAGAGACCAAGCTAGG - Exonic
1119846045 14:77830828-77830850 AGAAGCCCAGAGACCTACCTGGG - Intronic
1121068684 14:90995556-90995578 GTAAACCCAAAGAACTAGCTCGG + Intronic
1121953301 14:98191468-98191490 GCAAGCTAAAAGACATAGTTAGG + Intergenic
1124918915 15:34005391-34005413 GGAAGCAAACAGACCTAGCCTGG - Intronic
1125362641 15:38880292-38880314 GGAAGCCACAAAACCCAGCTGGG - Intergenic
1127387943 15:58482478-58482500 TGAAGCCATAAGACCTAGAGAGG - Intronic
1127833754 15:62773231-62773253 GCAAGCCACAACACCCAGCTTGG + Intronic
1129032462 15:72629037-72629059 AGAAGCCAGAAGCCCTACCTTGG + Intergenic
1129051832 15:72787325-72787347 GGAAGCAAAAACATCTAACTGGG + Intergenic
1129217429 15:74108202-74108224 AGAAGCCAGAAGCCCTACCTTGG - Intronic
1130742922 15:86620519-86620541 GGAAGCCAAAGGAGCTGTCTGGG - Intronic
1131179666 15:90231230-90231252 GGAAGCCAAAAGACACGGTTGGG + Intronic
1136389251 16:29951986-29952008 GGATGGCACATGACCTAGCTAGG - Intronic
1137779789 16:51088305-51088327 GGAAGTCAAAAGACCTGCCCAGG + Intergenic
1139295255 16:65895087-65895109 GGAAGCCAACAGCCCTAAGTGGG + Intergenic
1143710463 17:8731048-8731070 AGAAGTCAGATGACCTAGCTGGG + Intronic
1155241134 18:23864814-23864836 GCAAGCCAAAGGACTTGGCTTGG - Exonic
1157923504 18:51738074-51738096 GGAATCCAAGAGACGTGGCTGGG + Intergenic
1159451869 18:68612624-68612646 TGAAGCCAGAAGACCTATTTTGG + Intergenic
1161030999 19:2057688-2057710 AGAAGCCACCAGGCCTAGCTTGG - Intergenic
1162105492 19:8367305-8367327 GGAAGGCACAAGTCCTGGCTGGG + Intronic
1162874659 19:13611840-13611862 GAAAGCCAACAGGCCTGGCTGGG - Intronic
1164662054 19:29983208-29983230 GCAGGTCAGAAGACCTAGCTAGG + Intronic
1167293783 19:48637900-48637922 GGAAGCCAAAATACCGAGAGCGG + Intergenic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
1168040425 19:53754251-53754273 TGAATCCAAGAGACCTAGGTGGG - Intergenic
926645510 2:15286419-15286441 AGAAGTCAAAAGCCCTTGCTAGG + Intronic
926800769 2:16658524-16658546 GGAAGCAAACAGACCTGGGTTGG - Intronic
930737430 2:54793852-54793874 GGAAGAGAAAAGACCTAGGCTGG - Intronic
933465919 2:82651425-82651447 GTTATCCAAAAGATCTAGCTAGG - Intergenic
938058795 2:128236344-128236366 GGAAGCCAGAAGACCGGGGTGGG + Intergenic
940196231 2:151097320-151097342 TGAAGCCAAGAGCCCCAGCTGGG + Intergenic
940925158 2:159356173-159356195 GGAAGCCAACTGGTCTAGCTCGG + Intronic
945218467 2:207460417-207460439 GCAAGCCAAAAAACCTAGAAAGG + Intergenic
945666209 2:212746451-212746473 GGAAGCCTAGAGACATAGATGGG - Intergenic
1169006483 20:2211533-2211555 AGAAGCAAAAAGACCTTCCTTGG - Intergenic
1172336595 20:34121808-34121830 GGGAGACAAAAGACCAAGGTTGG + Intergenic
1172642959 20:36452478-36452500 GGAACTCAAAAGAAATAGCTAGG - Intronic
1173299913 20:41793347-41793369 GGAAGAGAACAGAGCTAGCTAGG + Intergenic
1173845882 20:46188333-46188355 GGAGGTCAAATGACCTGGCTTGG - Intronic
1173897310 20:46560853-46560875 GGCAGCCAGAAGACCCAGGTGGG - Intronic
1182925219 22:34116061-34116083 GGAAGCCTACAGGCCTAACTGGG + Intergenic
1183630927 22:39032105-39032127 GGCAGCCAGGAGACCTGGCTTGG + Intronic
1184045975 22:41972308-41972330 GGCCACCAACAGACCTAGCTTGG + Intergenic
1184482434 22:44755699-44755721 GGGGGCCCAAAGACCTAACTTGG - Intronic
951147902 3:19251410-19251432 GGAAGGCAGAAGAGCCAGCTGGG + Intronic
951205406 3:19921352-19921374 GGAAGCCCACAGACATAGCCAGG + Intronic
954455277 3:50594810-50594832 GGAAGCCAAAGGAGGTAGGTGGG - Intergenic
955459681 3:59168063-59168085 GGAAGCCAAATGTGCTGGCTGGG - Intergenic
958497609 3:94864606-94864628 GGATGCCTAAAGATCTACCTGGG + Intergenic
960196639 3:114776562-114776584 GGAAGCCAAAAGTCCAAAATCGG - Intronic
964649113 3:158991516-158991538 GGGAGCCAAATGGCCTGGCTTGG - Intronic
964709513 3:159656870-159656892 GGGAGTCAGAAGACCTGGCTTGG - Intronic
965097394 3:164249887-164249909 GGCAGCCAAAACACTTAGCTGGG + Intergenic
965656814 3:170995335-170995357 GGAAGGCAAAAGACACAGATGGG + Intergenic
969257966 4:6015420-6015442 GGATCCCAAAAGCCCAAGCTCGG - Intergenic
970490742 4:16571134-16571156 GAAATCCAAAATACTTAGCTTGG - Intronic
970946472 4:21698731-21698753 AGAAGCCAAAAGGCCTGTCTAGG - Intronic
973185733 4:47325688-47325710 GGAAGCCAAAAGAACTATGGTGG - Intronic
974707009 4:65531856-65531878 GAAAGCCCAAAGACCTAGGTAGG - Intronic
975883849 4:78941320-78941342 GGAAGCCATAAAACCTAGTAAGG - Intergenic
976624299 4:87162859-87162881 GGACACCAAAAGACCTAGCTGGG - Exonic
976993506 4:91400841-91400863 GGAAGCCAAAAGACCAATTCAGG - Intronic
979783696 4:124688554-124688576 GAAACGCAAAAGACATAGCTTGG + Intronic
980183032 4:129425558-129425580 GGAGGCCAGAAGATCTAGTTGGG - Intergenic
980733249 4:136848914-136848936 GGCAGCCAAATGGTCTAGCTCGG - Intergenic
980735397 4:136879557-136879579 GGAAGACAAAAAACCTAGAAAGG + Intergenic
983147548 4:164235909-164235931 GGAGGCCAAAAGAACTTGCATGG - Intronic
985097723 4:186429494-186429516 GGATGCCTAGAGTCCTAGCTGGG - Intronic
986946395 5:13027141-13027163 GGGAGTCAAAAGGGCTAGCTTGG + Intergenic
991602062 5:68362485-68362507 GGAAGCCAGAAAACCTAGGATGG + Intergenic
994118234 5:96084759-96084781 GGAATCTGAATGACCTAGCTTGG + Intergenic
1000950239 5:167472857-167472879 GGAAGCCAAAAGACCTAGCTGGG + Intronic
1001217456 5:169869111-169869133 GGAAGGCAAAGGACCTAGTGAGG - Intronic
1002515711 5:179756914-179756936 GGAAGGCAAAGAACCCAGCTCGG + Intronic
1002938605 6:1696749-1696771 GGAAGGCAGTGGACCTAGCTTGG - Intronic
1003556243 6:7142274-7142296 GGAAGCCACGAGAACTGGCTGGG - Intronic
1004128851 6:12899978-12900000 GGCAGCCAGAAAACCAAGCTAGG + Intronic
1005492785 6:26361941-26361963 GGAGGCCTGAAGACCCAGCTGGG + Intergenic
1005496950 6:26396062-26396084 GGAGGCCTGAAGACCCAGCTGGG + Intergenic
1005501720 6:26434538-26434560 GGAAGCCTGAAGACCCAGCTGGG + Intergenic
1010063822 6:71656656-71656678 GGAAACCAAAATATCTAGCAGGG - Intergenic
1012754949 6:103217186-103217208 GGAAGCCAAAAGACAAAACGGGG + Intergenic
1013817065 6:114111502-114111524 AGAGGCCAAAAGACCTAGGCAGG - Intronic
1016727582 6:147392802-147392824 GAAAGCTAAAACACCTGGCTGGG - Intergenic
1017268550 6:152479307-152479329 GGAAGGCAAGTGACCTAGGTAGG + Intronic
1022828022 7:34036524-34036546 GGAAGGGGAAAGACCTTGCTGGG + Intronic
1022882467 7:34602227-34602249 TCAAGGCAAAAGACCCAGCTAGG + Intergenic
1025073325 7:55920651-55920673 GTTATCCAGAAGACCTAGCTAGG + Intronic
1033183793 7:139206833-139206855 GGAATACAAAAGACCTAGAATGG + Intergenic
1033944174 7:146694571-146694593 GAAAGGCAAAAGACCCAGCATGG - Intronic
1037611030 8:20476513-20476535 GGAACCGAAAAGACCAGGCTTGG - Intergenic
1038584773 8:28778689-28778711 TTGAGCCAAAAGACCTCGCTCGG + Intronic
1039131802 8:34273363-34273385 GGGAGACAGAAGACCTGGCTGGG - Intergenic
1040775634 8:51039865-51039887 GCAAGTCAAAAAACCTAACTGGG + Intergenic
1042444766 8:68871197-68871219 GGAAGCCAACTGAACTAGCCAGG - Intergenic
1043750652 8:83929502-83929524 GGAAGCCCCAAGAGCTTGCTGGG + Intergenic
1044099266 8:88111729-88111751 GGAAGCAAAAAAACCAATCTGGG + Intronic
1044300524 8:90577929-90577951 TAAAGCAAAAAAACCTAGCTGGG + Intergenic
1047317436 8:123747570-123747592 GGAAGGAAAAAGACCAAGCCAGG + Intergenic
1047850986 8:128857917-128857939 GGAAGCCAAAAGACCAAAGTAGG - Intergenic
1050273979 9:3977204-3977226 AGATGACAAAAGACCTTGCTAGG + Intronic
1050716207 9:8529235-8529257 GGAAGCCAACAGTGCCAGCTTGG + Intronic
1052734451 9:32325898-32325920 GGAAGAAAAAAGCCCTAGTTTGG + Intergenic
1052787232 9:32840187-32840209 GAAAGTTAAAAGACTTAGCTAGG - Intergenic
1056550447 9:87648970-87648992 GGAAGACAGAAAGCCTAGCTTGG - Intronic
1059850139 9:118329115-118329137 GGGAGCCAGAAGAGTTAGCTTGG + Intergenic
1060867367 9:127010969-127010991 AGAACCCAAAAGACCCAGATGGG - Intronic
1061624147 9:131831374-131831396 GGAGGCCAGAGGACCCAGCTCGG + Intergenic
1062309378 9:135927627-135927649 GGAAGCCAGGAGGCCTTGCTTGG + Intergenic
1185928057 X:4169422-4169444 GGGGGCCAAGAGACCCAGCTTGG - Intergenic
1189319547 X:40079454-40079476 GGTGGACAAAAGACCTAGTTAGG - Intronic
1191641669 X:63433827-63433849 GGAAGTCAAAAGTCCCATCTGGG + Intergenic
1192193765 X:69015316-69015338 GCCAGCCAACAGACCTAGCAGGG - Intergenic
1194152649 X:90344602-90344624 TGAACCCCAAAGGCCTAGCTGGG + Intergenic
1197931853 X:131704491-131704513 GAAGGCAAGAAGACCTAGCTTGG - Intergenic
1197936042 X:131741325-131741347 GAAAGCTAGAAGACCTAGCCTGG - Intergenic
1197937255 X:131752749-131752771 GAAAGCAAGAAGACCTAGCCTGG - Intergenic
1200498996 Y:3921347-3921369 TGAACCCCAAAGGCCTAGCTGGG + Intergenic