ID: 1000952321

View in Genome Browser
Species Human (GRCh38)
Location 5:167499462-167499484
Sequence GAAGTTGCTCCATTGTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000952321 Original CRISPR GAAGTTGCTCCATTGTAGGG TGG Intronic
904886626 1:33743196-33743218 GAAGGTGCTCCCATGGAGGGAGG - Intronic
905736536 1:40331554-40331576 GAAGTTGTTCCAGTGTTGGCTGG + Intergenic
908511134 1:64850741-64850763 CAAGCTGCTCCATCGTGGGGAGG + Intronic
909513221 1:76478330-76478352 GAAGTTACTCTACTGTATGGTGG + Intronic
909584991 1:77280110-77280132 GAAGTTGTGGCTTTGTAGGGAGG - Intergenic
917454918 1:175178034-175178056 AAATTTGCTCCAATGTTGGGAGG + Intronic
921431838 1:215074886-215074908 GAATTTACTCCATTTTCGGGAGG - Intronic
921666045 1:217872359-217872381 TAATTTGCTGCTTTGTAGGGGGG + Intergenic
923266893 1:232323174-232323196 GTAGCTGCTTCAATGTAGGGAGG - Intergenic
924312518 1:242759024-242759046 GATGTTGCTCCATTGTCCTGTGG - Intergenic
924671894 1:246136764-246136786 GAAGTTGCTGAATGGTAGGCTGG + Intronic
1063927818 10:10997771-10997793 GTAGTCGCTCACTTGTAGGGTGG + Intergenic
1064259630 10:13774696-13774718 GCAGATGCTCCATTTCAGGGTGG - Intronic
1064845727 10:19650667-19650689 GGAGTTTCTCAATTATAGGGAGG + Intronic
1065672618 10:28137161-28137183 GATGTTGCTCCATTGTTTTGTGG - Intronic
1072105926 10:92273912-92273934 GAAGTTGCTGCATGTTAGAGTGG - Intronic
1072776466 10:98201156-98201178 GATGTGGATCCATTTTAGGGGGG + Intronic
1075587703 10:123669402-123669424 GTACTTGCTCATTTGTAGGGAGG - Intronic
1078619298 11:12892795-12892817 GCAGTTGCTCCATCTTGGGGTGG + Intronic
1079078149 11:17396306-17396328 GAGGTGGCTCCATTGTAGGGCGG - Intronic
1082776346 11:57247583-57247605 GCTGTTGCTTCATTGGAGGGAGG + Intergenic
1083411243 11:62493868-62493890 GAATTTGCTTCATTATGGGGAGG - Intronic
1084344661 11:68538524-68538546 GAAGTTGCTCTATTTTCTGGGGG - Intronic
1086401906 11:86467835-86467857 CAAATTGCTCCATGGGAGGGAGG - Intronic
1099706005 12:86153603-86153625 GAAGTGACTGGATTGTAGGGAGG + Intronic
1101140269 12:101788766-101788788 GAATTTGCTCCAATATAAGGTGG + Intronic
1104760187 12:131293530-131293552 GAGGTTGCTCCAGTGCAGGATGG - Intergenic
1106133529 13:26958333-26958355 GGGGTTGCTCCATGGGAGGGTGG + Intergenic
1106976714 13:35226314-35226336 GAAGCAGCTCCCTTCTAGGGAGG + Intronic
1109376538 13:61501817-61501839 GAAGTTACACCATTGTGGGGAGG + Intergenic
1111317111 13:86577613-86577635 GATGTTGGCCCATTGTAGGGTGG + Intergenic
1112162120 13:96878699-96878721 GATGTTGATGCATAGTAGGGTGG - Intergenic
1112312676 13:98333548-98333570 GTCGTTGCTCCATTATAGTGAGG + Intronic
1141241944 16:82272922-82272944 GAAGATGCTGCATTGTCAGGAGG - Intergenic
1141773974 16:86110087-86110109 GATGTTCCCCCATTGTTGGGTGG + Intergenic
1152573850 17:81131737-81131759 GAAGCTGCGCCATGGGAGGGTGG - Intronic
1159667934 18:71186230-71186252 TAAGTTGCTTTATTTTAGGGAGG - Intergenic
1162021987 19:7872267-7872289 GGAGTGGCTGCATTGTCGGGAGG + Exonic
1167157520 19:47748297-47748319 TAAGTTGCTAGAATGTAGGGTGG + Intronic
928909605 2:36406252-36406274 GTAATTGTTCCATTGGAGGGAGG + Intronic
930211471 2:48643128-48643150 GATGTTGCTCCATTCTAGAGGGG - Intronic
931786516 2:65623771-65623793 GAAGTTTCTCAAATGTAGGAAGG - Intergenic
932119121 2:69082060-69082082 GAAGTAGCTCCATTTCAGAGAGG + Intronic
932689256 2:73898379-73898401 TCAGTTTCTCCATTGTATGGAGG + Intronic
937665571 2:124483253-124483275 GGAGTTGCTACATTGTAGGGAGG + Intronic
940664204 2:156587509-156587531 GGAGTTGCTTCAATCTAGGGAGG + Intronic
941312200 2:163947609-163947631 GAAGTTGATACATTGTAAGGTGG + Intergenic
944732525 2:202531821-202531843 GAGGTTTCTCCATGTTAGGGTGG + Intronic
945849061 2:214983711-214983733 GAAGGTGCTCCTTAGTAGTGAGG + Exonic
946837070 2:223783311-223783333 GAAGTTGCCCCTTTGGAGGTGGG - Intronic
947507294 2:230717905-230717927 GAAGTGGCTCCAAAGGAGGGAGG + Intronic
948453483 2:238093108-238093130 GAAGGTGCTGCATTGGAGGCAGG - Intronic
1173734930 20:45353711-45353733 GAATTATCTCCATTGTAGGGAGG - Intergenic
1174473323 20:50777766-50777788 AAAGTTGCTTCTTTGGAGGGGGG - Intergenic
1175132316 20:56798603-56798625 GCAGTTCCTCCATTGAATGGAGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
950107841 3:10399463-10399485 GATGTTCCACCATTGTAGTGAGG - Intronic
950409506 3:12826097-12826119 AAAGTTGAACCATTGTAAGGCGG - Intronic
954941748 3:54379483-54379505 GCAGTTGCAGCATTGCAGGGTGG + Intronic
955808658 3:62762934-62762956 GAAGTTGTGGCATGGTAGGGTGG + Intronic
956373395 3:68588261-68588283 GATGTTGCTCCAAAGTGGGGAGG - Intergenic
956483135 3:69693056-69693078 GAAGTTGCTGCAATGTTAGGCGG + Intergenic
963896262 3:150688157-150688179 GAAGTTGATCTATTTTGGGGAGG + Intronic
968439066 4:612481-612503 GAAGCTTCTCCATGGCAGGGTGG - Intergenic
973246209 4:48013894-48013916 TGAGTTGCTACATTGTAGGGAGG - Intronic
976187744 4:82459182-82459204 TAACTTGCTCCATTCTAGGCTGG + Intronic
981140209 4:141259244-141259266 GAAGTTGCTACCTTGAAGGGAGG + Intergenic
981666756 4:147236600-147236622 GACGTTCCTTCATTTTAGGGTGG + Intergenic
985009521 4:185568311-185568333 GAATTTCCTCCATTCTAGTGTGG + Intergenic
985911400 5:2886772-2886794 GAGGTGGATCCATTGCAGGGGGG + Intergenic
987302251 5:16607109-16607131 GAAGTTACTACTTTGTTGGGTGG - Intronic
989186660 5:38632540-38632562 GGAGTTGCTGCATTGTATTGGGG + Intergenic
1000952321 5:167499462-167499484 GAAGTTGCTCCATTGTAGGGTGG + Intronic
1003037975 6:2661748-2661770 GAAGCTGCACCCTTGTCGGGGGG + Intergenic
1004731208 6:18360914-18360936 GAAGTAGCTCCAATGGAAGGGGG + Intergenic
1006413311 6:33888355-33888377 GAAGTTGCACCTTTCTCGGGGGG - Intergenic
1007318702 6:41010673-41010695 TAAGTTGATCCATTGAAGGTTGG - Intergenic
1009637376 6:66283648-66283670 AAAGTTGCTCCATTGTGGCAGGG + Intergenic
1013191861 6:107810401-107810423 GAAGTTGCACCACTGTGGGCAGG + Intronic
1018020489 6:159758784-159758806 GAATTTGCTGCATGGTAGGTTGG + Intronic
1022439475 7:30421567-30421589 GAAAATACTCCATTTTAGGGGGG - Intergenic
1027364594 7:77444350-77444372 GAAATTGCTCCCTTGTACGTTGG - Intergenic
1033104659 7:138510053-138510075 GAGCTAGCTCCATTGTAGGAAGG + Intronic
1037361850 8:18082886-18082908 AAAATTGCTCCATTGTGGGTAGG - Intronic
1039595684 8:38788039-38788061 GACGTTGCTCCAGTGTGGAGGGG - Intronic
1040801605 8:51348124-51348146 GGAGATGCTGCATTGTAGTGGGG - Intronic
1046184498 8:110694864-110694886 AAAGGTGATCCATTGTTGGGGGG + Intergenic
1049720589 8:144113722-144113744 GAAGCTGCTCCAATGGATGGGGG + Exonic
1049995045 9:1026736-1026758 AAAGTGGCTCCTTTGGAGGGTGG + Intergenic
1051177616 9:14376898-14376920 GAAGTTGTATCATTGTAGGAAGG - Intronic
1051226552 9:14905401-14905423 GATTTTGCTCCATTGTAGCAAGG - Intronic
1053148509 9:35728125-35728147 GAAGTTGGGCAATTGGAGGGGGG + Intronic
1062597167 9:137304596-137304618 GAAGCTGCTCCATTTGAGGATGG + Intergenic
1191912806 X:66169144-66169166 GAAGTTTCTCCATTGTAATATGG + Intronic