ID: 1000952450

View in Genome Browser
Species Human (GRCh38)
Location 5:167500880-167500902
Sequence AGGAGGACATTTAGTACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000952450 Original CRISPR AGGAGGACATTTAGTACTGG GGG (reversed) Intronic
900619065 1:3578691-3578713 AGGCGGACAGTTGGTGCTGGAGG - Intronic
901206902 1:7502702-7502724 ATGAGGACACTGAGCACTGGAGG + Intronic
906694143 1:47812815-47812837 TGGAAGACATTCAGTAGTGGAGG + Intronic
909318959 1:74258115-74258137 TGGAGGTCATGTAGTACGGGGGG - Intronic
911990398 1:104689146-104689168 GGGAGGACATTTAATCATGGGGG - Intergenic
917690417 1:177462672-177462694 AGAAGGACATTTAGAAAAGGAGG + Intergenic
918919946 1:190696345-190696367 TGTAGGATATTTAGTACTGCCGG + Intergenic
919527290 1:198669356-198669378 AGGAGGACATTGGGTGCAGGTGG - Intronic
1063738445 10:8789883-8789905 AGTAAGACATTTAGTTTTGGGGG - Intergenic
1064902429 10:20309792-20309814 AGGTGGACATTTACTAAAGGTGG + Intergenic
1065795626 10:29304998-29305020 AAGAGCACATTTTGTACTAGGGG - Intronic
1068235928 10:54232154-54232176 AGGAGGTCATTGAATAATGGGGG + Intronic
1071415406 10:85436684-85436706 AGGAGGATATTTTGAATTGGGGG - Intergenic
1071433250 10:85623072-85623094 AAGACGACATTTAGGAATGGAGG - Intronic
1077395781 11:2320508-2320530 GGGAGGACATTTAGTGCGGAGGG - Intergenic
1078752780 11:14180778-14180800 AGGAGGTCACTTAGTAGTGGAGG - Intronic
1078980962 11:16534694-16534716 AGGAGGACAGTTTGTTCTTGGGG - Intronic
1079949004 11:26778652-26778674 AGGCTGACATGTGGTACTGGTGG - Intergenic
1080768516 11:35318809-35318831 AGGATGACATTTTGTTCAGGGGG + Intronic
1082016394 11:47491638-47491660 AGGTGGAAATTTAGTACTGTTGG - Intronic
1097899678 12:64859993-64860015 AGAAGAATCTTTAGTACTGGAGG - Intronic
1097947088 12:65381085-65381107 AGCAGGAAATTTAATGCTGGGGG - Intronic
1099619876 12:84989509-84989531 AGGAGCAAGTTTAGTACTAGAGG + Intergenic
1101125381 12:101628324-101628346 AGGAGCACATTTAGAACATGAGG - Intronic
1101748639 12:107564354-107564376 AGGAGAAAAAGTAGTACTGGTGG - Intronic
1102248739 12:111371507-111371529 AGGAGGTCATTGAGTCATGGGGG - Intergenic
1104218876 12:126762755-126762777 AGGAGGTCATTGAATAATGGGGG - Intergenic
1104425484 12:128673746-128673768 AGAAGGAGACTGAGTACTGGAGG - Intronic
1107950048 13:45453474-45453496 AGGAGGCCAGTGAGTCCTGGTGG - Intergenic
1112727603 13:102322346-102322368 AGGAACATATTTATTACTGGTGG + Intronic
1113267367 13:108634309-108634331 AGGAGGAAATTCAGGACTGCAGG - Intronic
1113626987 13:111854800-111854822 TGGAGGGCATTTGGGACTGGCGG + Intergenic
1115971032 14:38945052-38945074 ATGAGGACATTTACTACTCTAGG - Intergenic
1116966190 14:51017586-51017608 AGGAGAACATTTACCACTGAAGG + Intronic
1119943002 14:78660908-78660930 AGTAGGAAATGTAATACTGGAGG + Intronic
1123998817 15:25737616-25737638 TGGAGGATTTTTAGAACTGGAGG + Intronic
1126331598 15:47537941-47537963 AGGAGAACAGTTAGCATTGGAGG + Intronic
1127460163 15:59191281-59191303 AGGTGGATATTTAGTACAGACGG - Intronic
1133632851 16:7638307-7638329 AGGAGGAAATTTAGGCTTGGGGG + Intronic
1134428283 16:14174687-14174709 AGGAAGACATTTTTTTCTGGGGG - Intronic
1135340163 16:21638367-21638389 AGCAGGACAATTAGTACTGTTGG + Intronic
1135826878 16:25736715-25736737 AGGAGGACACTGGGAACTGGAGG - Intronic
1139424327 16:66869793-66869815 AGGAGGACACTTTGGCCTGGAGG - Intronic
1139469313 16:67169875-67169897 GAGAGGCCATTTAGTAGTGGGGG - Exonic
1139486635 16:67260633-67260655 AGGAGGAGACAGAGTACTGGGGG + Intronic
1140942360 16:79734136-79734158 AGGAGGAGAGGTAGTAGTGGTGG - Intergenic
1147447510 17:40483638-40483660 AGGAGGACACTGTGGACTGGTGG - Intronic
1148239008 17:45987880-45987902 CGGTGCACATTTAGTGCTGGGGG + Intronic
1152157218 17:78642311-78642333 AGGAGGACAATGGTTACTGGGGG - Intergenic
1155730109 18:29146264-29146286 AGGAAGATCTTTAGTACTGAAGG + Intergenic
1155884219 18:31187504-31187526 AAGAGGACATTTAATTCTGTAGG + Intergenic
1156108330 18:33692497-33692519 AGGAGGACTTTGAGCCCTGGTGG - Intronic
1159254186 18:65924375-65924397 AGGAGGAAATTGAATAATGGGGG + Intergenic
1160013029 18:75120910-75120932 AGGAGCTCTTTTGGTACTGGGGG - Intergenic
1164908376 19:31985758-31985780 AGGAGGACATGGAGTTTTGGAGG + Intergenic
1166080311 19:40440117-40440139 AAGAGGTCTTTTAGTACTGGGGG + Intergenic
925425598 2:3746787-3746809 AGGAGGACCTTGAGCCCTGGGGG + Intronic
926346193 2:11947941-11947963 AGGAGGATATTGAGTATTGAAGG - Intergenic
928601161 2:32904831-32904853 AGGAAGACATCAAGTCCTGGAGG - Intergenic
930410138 2:51015119-51015141 ATGAGGACATTGAGAACTGTTGG - Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931554656 2:63489077-63489099 AGGAGGACATTTACATATGGGGG + Intronic
938504019 2:131856198-131856220 AGGAGTACATTTGCTGCTGGAGG - Intergenic
941730696 2:168913828-168913850 AGAAGGCCATTTAGTGTTGGTGG + Intergenic
941746574 2:169093102-169093124 AGGAGGTCAGTGAGTACTTGAGG - Intronic
944136387 2:196404721-196404743 AGGAGGAAATTGATAACTGGGGG - Intronic
944891812 2:204125414-204125436 AGGAGGGCATTTAGGTCTGAAGG - Intergenic
945512198 2:210716506-210716528 AGGAGGAGTATTAGTAATGGAGG - Intergenic
1171364679 20:24615760-24615782 AGGAGGACATTAAGAACTTCGGG - Intronic
1173116220 20:40245686-40245708 AGTAGGACATTTACCTCTGGTGG - Intergenic
1173656798 20:44705020-44705042 GGGAGGACATTTGCAACTGGAGG - Intergenic
1174304934 20:49608414-49608436 AAGAGGACATTTCGGGCTGGAGG - Intergenic
1174780449 20:53384271-53384293 AGGAAGACATTCATTACTGAAGG + Intronic
1177992419 21:28053982-28054004 AGGAGTACATTTGCTGCTGGAGG + Intergenic
1178065631 21:28901758-28901780 AGGAGGCCATTTCGTGCTGGAGG - Intergenic
950637936 3:14329048-14329070 GGGAGGACAGTAAGGACTGGTGG + Intergenic
955024156 3:55151238-55151260 AGGAGCACATGTAAAACTGGTGG - Intergenic
958728534 3:97935479-97935501 AGGAGGACTTTTCTTAGTGGTGG + Intronic
959146797 3:102556647-102556669 AGGAGGACATTGAGCATTGAGGG + Intergenic
966478559 3:180378719-180378741 AGGAGGTCATCTGGAACTGGTGG - Intergenic
971234699 4:24830271-24830293 TGGAGGACATTTCGTGCTGCAGG + Intronic
973312447 4:48724189-48724211 TGGAGGACTTTGAGTATTGGTGG - Intronic
979144455 4:117224506-117224528 AAGAGGAGATTTAATACAGGAGG - Intergenic
980234405 4:130086480-130086502 AGGAGGAAAGTGAGCACTGGAGG + Intergenic
982560090 4:156919012-156919034 AAGAGGACATTTAATATTGTTGG - Intronic
984113585 4:175649962-175649984 AGGAAGACATTTAGGACAAGGGG + Intronic
987744672 5:21954720-21954742 AGGAGGGGTTTTAATACTGGAGG + Intronic
989093172 5:37755694-37755716 AGGAGGATCGTTAGTACTGAAGG + Intergenic
990528894 5:56654674-56654696 ATGAGGACATTGAGGACCGGAGG - Intergenic
993083489 5:83333023-83333045 AGGAGAACATTTAATACTTGTGG + Intronic
995004443 5:107174111-107174133 AGGAGGTAATTGAGTAATGGAGG - Intergenic
995524910 5:113043059-113043081 AGGAGGAGATAAAGAACTGGGGG + Intronic
1000952450 5:167500880-167500902 AGGAGGACATTTAGTACTGGGGG - Intronic
1001822331 5:174720248-174720270 ATGGGGACATCTAGTTCTGGAGG - Intergenic
1005229044 6:23678378-23678400 AGGAAGACATTTAGCATAGGAGG - Intergenic
1007179348 6:39917362-39917384 AGGAGGTAATTTAATAATGGGGG - Intronic
1007840798 6:44714442-44714464 AGGAGGATATTTAATTCTTGGGG - Intergenic
1028122007 7:87066567-87066589 AGGAGAACATATATTTCTGGAGG + Intergenic
1038625182 8:29185657-29185679 AGGAGGACATTTAGTTTTGCTGG - Intronic
1038672725 8:29595439-29595461 AGGAGGACCTTTTGGGCTGGAGG + Intergenic
1039050379 8:33487327-33487349 AAGAGCACATTAAGTACAGGAGG + Intronic
1044952836 8:97450560-97450582 AGGATGACATTTTCTACTTGTGG - Intergenic
1047494835 8:125402146-125402168 AGGGGGACATGGAGGACTGGAGG - Intergenic
1047801465 8:128314795-128314817 AGGAGGACAATCAGAGCTGGTGG - Intergenic
1048237933 8:132710673-132710695 AGGGGGACATTTATTCCAGGCGG + Exonic
1049581063 8:143411214-143411236 GGGAGGACATTTAGTGGGGGCGG + Intergenic
1051552121 9:18341496-18341518 TGGAGGACATTTATTTATGGAGG - Intergenic
1052187740 9:25619822-25619844 AGGATGACATTTAGTATCTGTGG + Intergenic
1055328623 9:75159034-75159056 AGGAGGAAATTTAGAACTGAGGG + Intergenic
1058199313 9:102019076-102019098 AAGAGGGCATTTATTACTAGAGG + Intergenic
1060356331 9:122912492-122912514 AGGAGGACCTGTTGTAGTGGTGG - Intronic
1186154273 X:6709370-6709392 GGAAGGACATTTGGGACTGGAGG - Intergenic
1188888377 X:35579163-35579185 AGAAGCACTTTTAGAACTGGTGG + Intergenic
1190224282 X:48533589-48533611 AGGAGGACTTTGAGGAATGGGGG - Intergenic
1192868897 X:75166728-75166750 AAGAGAAGATTTATTACTGGGGG - Intergenic
1196990190 X:121320305-121320327 AGGAGGACAGTGAATACTTGGGG + Intergenic
1197633647 X:128890592-128890614 AGCAAGACATTTAGCTCTGGAGG - Intergenic