ID: 1000954034

View in Genome Browser
Species Human (GRCh38)
Location 5:167521052-167521074
Sequence GTTCCATATGACCATGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000954034_1000954039 5 Left 1000954034 5:167521052-167521074 CCAATAACATGGTCATATGGAAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1000954039 5:167521080-167521102 ATTCTGGAGAGACTGAGGTTGGG 0: 1
1: 0
2: 0
3: 27
4: 271
1000954034_1000954036 0 Left 1000954034 5:167521052-167521074 CCAATAACATGGTCATATGGAAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1000954036 5:167521075-167521097 TGACCATTCTGGAGAGACTGAGG 0: 1
1: 0
2: 0
3: 21
4: 227
1000954034_1000954041 21 Left 1000954034 5:167521052-167521074 CCAATAACATGGTCATATGGAAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1000954041 5:167521096-167521118 GGTTGGGGTTGTTATTGCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 221
1000954034_1000954038 4 Left 1000954034 5:167521052-167521074 CCAATAACATGGTCATATGGAAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1000954038 5:167521079-167521101 CATTCTGGAGAGACTGAGGTTGG 0: 1
1: 0
2: 9
3: 152
4: 1245
1000954034_1000954040 6 Left 1000954034 5:167521052-167521074 CCAATAACATGGTCATATGGAAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1000954040 5:167521081-167521103 TTCTGGAGAGACTGAGGTTGGGG 0: 1
1: 1
2: 2
3: 48
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000954034 Original CRISPR GTTCCATATGACCATGTTAT TGG (reversed) Intronic
901317662 1:8319582-8319604 GTACCATATGACCATTTACTCGG - Intronic
902689587 1:18101925-18101947 GATCCATAAAACAATGTTATAGG + Intergenic
909266660 1:73568071-73568093 GTTGCATATGAACATTCTATTGG - Intergenic
911211888 1:95149205-95149227 GTTACAGATGGCCATGTGATAGG + Intronic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
916728695 1:167546932-167546954 GTTTAACATGTCCATGTTATGGG - Intronic
917177645 1:172254844-172254866 TTTCCAAATGAAAATGTTATAGG + Intronic
1068171350 10:53398730-53398752 TTTCCATATGATCATGACATGGG - Intergenic
1070348058 10:75564785-75564807 GGTCAGTATGACCATGGTATGGG + Intronic
1071717337 10:88110652-88110674 GTGCCATAGGAACATGTTATGGG + Intergenic
1081472406 11:43387721-43387743 GTCCCATGTGACCCTTTTATAGG - Intronic
1081760167 11:45571416-45571438 GTTCCATTTGACCAGGGTCTGGG - Intergenic
1084052057 11:66606335-66606357 TTCCCATATTCCCATGTTATGGG - Intergenic
1084774726 11:71367943-71367965 GGTCCACATGACCCTGTGATGGG + Intergenic
1090176795 11:124657044-124657066 TTTCCATCTGGCCATCTTATTGG - Intronic
1092756717 12:11770390-11770412 GTTGCCTATGCCCATGTTAAAGG + Intronic
1105452575 13:20513295-20513317 CTTCCATTTGACCATGTCTTAGG + Intronic
1114593979 14:23895402-23895424 GTTCTATAGGAACATGTTACTGG - Intergenic
1116451189 14:45067659-45067681 GAACCATATTACCATGTCATGGG + Intronic
1122030196 14:98906406-98906428 ACTCCATATGACCATGGTGTTGG + Intergenic
1137819701 16:51432228-51432250 TTTCCTTTTGACAATGTTATAGG + Intergenic
1149207071 17:54260693-54260715 GTGGCATGTGACCATATTATAGG + Intergenic
1150287256 17:63961361-63961383 GTTCCATATGAGCACTTTGTGGG + Exonic
1150692874 17:67379596-67379618 GTTGCATATGACCTTGTAAGTGG + Intronic
1158564539 18:58543524-58543546 GTTGCAGATGACCACGTTCTGGG + Intronic
1164857370 19:31535568-31535590 TTTCCGTATGACCAGGTGATGGG - Intergenic
926628440 2:15115294-15115316 GTTACATGTTGCCATGTTATAGG - Intergenic
929012146 2:37455842-37455864 GCTCCATATGACCTTGATCTGGG - Intergenic
931798330 2:65733508-65733530 GTCCCAAATGACCATGTGAAAGG + Intergenic
933040249 2:77455823-77455845 GTTCCAAATGAAGATTTTATTGG - Intronic
939135497 2:138288633-138288655 GTTGCATATGAGAATGTGATTGG - Intergenic
940684995 2:156837728-156837750 GTTCAATATAACCATATTATAGG - Intergenic
942855361 2:180540004-180540026 ATGCCATATGACCCTATTATAGG + Intergenic
947429456 2:230013279-230013301 GCTGCCTATTACCATGTTATGGG - Intergenic
947761697 2:232607979-232608001 GTTCCATATTATCTTGTTAGTGG - Intronic
1170542805 20:17406120-17406142 GCTCCAAATGTCCATGTTAATGG + Intronic
1174135933 20:48379343-48379365 GTTCTATATAACTATGTTCTGGG + Intergenic
1182944256 22:34306986-34307008 ATTGCATATGACCATCTTCTTGG + Intergenic
949217583 3:1588079-1588101 GTTCCATTGGTCAATGTTATTGG - Intergenic
949331199 3:2924633-2924655 TTTCCATAGGACTATGTTACTGG + Intronic
951740420 3:25915838-25915860 ATTACATATGACCATGTCTTAGG + Intergenic
959832112 3:110876338-110876360 GTGACATATGAACAAGTTATTGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964340365 3:155702512-155702534 ATTCCGTATGACAATGTTAATGG + Intronic
964691035 3:159450190-159450212 GTTCTACATGACCATGTTTTTGG + Intronic
967279973 3:187812845-187812867 GTTCCATAAGAACATTTTATTGG + Intergenic
972544011 4:40063243-40063265 GGTTCATATGACCATATAATAGG + Intronic
973113157 4:46420452-46420474 TTTCCATATGTCTATGTTATAGG - Intronic
974150763 4:58005955-58005977 GTTTCATATGTACATGTTAAAGG - Intergenic
975079356 4:70256881-70256903 TTGCCATATGTCCATGATATTGG + Intergenic
975282668 4:72579704-72579726 GTTCCAGATTACAATGCTATAGG - Intergenic
977996330 4:103500862-103500884 GTTCCATATGAAAAGGTTATTGG + Intergenic
979750059 4:124268214-124268236 GTTCCACATGACAAAGTTACAGG - Intergenic
982071810 4:151702064-151702086 ATGCCATATGACAATCTTATGGG + Intronic
986559838 5:9049546-9049568 GTTCCATGTGAACATGTCAGAGG + Intronic
988430519 5:31113821-31113843 GATCCTACTGACCATGTTATGGG - Intergenic
990133762 5:52620323-52620345 TTTCCAGATGACCATGTAACAGG - Intergenic
990631973 5:57680328-57680350 GTTCCATATGACACTGCTCTTGG + Intergenic
991406069 5:66302281-66302303 GTTCCATATGACCTTGACCTTGG + Intergenic
994698704 5:103105304-103105326 CTACCAAATGACCATCTTATTGG + Intronic
1000779078 5:165456931-165456953 GTTCCATATAACCATTTTCTTGG + Intergenic
1000954034 5:167521052-167521074 GTTCCATATGACCATGTTATTGG - Intronic
1009598162 6:65763279-65763301 GTTCCAGATCACCATGTTTTGGG + Intergenic
1011864916 6:91813569-91813591 TTTCCATATGACCACGAAATAGG + Intergenic
1013435606 6:110102324-110102346 TTTCTATAGGAGCATGTTATTGG - Intronic
1015123516 6:129727071-129727093 ATTCCATGTCAACATGTTATAGG - Intergenic
1016636268 6:146295550-146295572 ATTCCATATCACTATGTTTTTGG + Intronic
1020705439 7:11538119-11538141 GTTGCCTATGCCCATGTCATTGG + Intronic
1022847719 7:34227474-34227496 GAACCATAAGAACATGTTATGGG - Intergenic
1028561148 7:92178013-92178035 TTTCCATATGAGCATTTTAAAGG + Intronic
1033810747 7:145007971-145007993 GTTCCATATTGCCTTTTTATGGG + Intergenic
1034775935 7:153826726-153826748 CTTCCATATGCACTTGTTATTGG + Intergenic
1035971200 8:4251245-4251267 CTTCCATATACCCATGTGATTGG - Intronic
1038993072 8:32890708-32890730 ATTCCAGATGATCTTGTTATGGG + Intergenic
1043151757 8:76726438-76726460 TTTCCATATTCCCAAGTTATGGG - Intronic
1044454001 8:92370468-92370490 GCTACATATGACCAGATTATAGG + Intergenic
1045629270 8:104098345-104098367 GTTCCATATTAAAATGTCATCGG + Intronic
1045673688 8:104586256-104586278 TTTCCAGATGACGATTTTATGGG - Intronic
1045889680 8:107140663-107140685 GTTCTATTTGACCATTTGATGGG - Intergenic
1046181393 8:110653993-110654015 GGTCCACATGACCAAGTTAAAGG + Intergenic
1051370370 9:16354284-16354306 GTTCCATTTGACTATGGCATGGG - Intergenic
1051492422 9:17681434-17681456 GTGACATATGACCATGCTACAGG - Intronic
1052720859 9:32169470-32169492 GGTCCAAGTGACCATGTTATAGG - Intergenic
1057139305 9:92717109-92717131 GTGCCATATGGCCAAGTTCTTGG + Intronic
1059062649 9:111049746-111049768 GTTACATATACCCATGTTAGTGG - Intergenic
1194666587 X:96683587-96683609 GATGCATTTGACCATGCTATAGG - Intergenic
1194849622 X:98855221-98855243 GTTCCATAGCACCATACTATAGG - Intergenic
1194983494 X:100464636-100464658 AATCCATATGGCCATGTTGTTGG - Intergenic
1196386764 X:115162769-115162791 GGTTAATATGACCATGTTTTGGG - Intronic
1197279648 X:124520193-124520215 GTTCTATAAGGCCATGTTTTTGG - Intronic
1198910118 X:141604354-141604376 GTTCCATGTAATCATGTTCTTGG - Intronic