ID: 1000955047

View in Genome Browser
Species Human (GRCh38)
Location 5:167533348-167533370
Sequence TGTACAGGCTTGAGTACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 965
Summary {0: 1, 1: 0, 2: 2, 3: 85, 4: 877}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000955044_1000955047 9 Left 1000955044 5:167533316-167533338 CCATGTTCATAGTGGTTTTGGAA 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1000955047 5:167533348-167533370 TGTACAGGCTTGAGTACAATGGG 0: 1
1: 0
2: 2
3: 85
4: 877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000955047 Original CRISPR TGTACAGGCTTGAGTACAAT GGG Intronic
900460317 1:2799500-2799522 TGCCCAGGCTGGAGTGCAATGGG - Intronic
901267718 1:7924584-7924606 TGCCCAGGCTGGAGTGCAATGGG - Intronic
901286288 1:8081655-8081677 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
901542892 1:9932302-9932324 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
901719552 1:11185563-11185585 TGTTCAGGCTAGAGTGCAATGGG - Intronic
901726811 1:11249182-11249204 TGCCCAGGCTGGAGTACAGTTGG - Intronic
902118011 1:14137747-14137769 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
902557348 1:17254756-17254778 TGCCCAGGCTGGAGTGCAATGGG + Intronic
903272706 1:22201544-22201566 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
903327644 1:22580178-22580200 TGCCCAGGCTGGAGTGCAATGGG + Intronic
903355394 1:22743509-22743531 TGCCCAGGCTGGAGTGCAATGGG + Intronic
903692195 1:25182423-25182445 TGGACAGGCTGGAGTGCAGTGGG - Intergenic
903803141 1:25984887-25984909 TGCCCAGGCTGGAGTACAATGGG + Intronic
904140632 1:28350232-28350254 TGCTCAGGCTGGAGTACAATGGG - Intergenic
904140684 1:28350657-28350679 TGCCCAGGCTGGAGTACAATGGG + Intergenic
904658078 1:32064376-32064398 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
904694090 1:32317998-32318020 TGCCCAGGCTGGAGTGCAATGGG + Intronic
904737948 1:32649703-32649725 TGCCCAGGCTGGAGTGCAATGGG + Intronic
905188423 1:36213804-36213826 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
905569997 1:38996133-38996155 TGCCCAGGCTGGAGTCCAATGGG + Intronic
905581537 1:39086143-39086165 TGTACATGCTAGAGATCAATTGG + Intronic
905597277 1:39218819-39218841 TGTCCAGGCTGGAGTGCAATGGG + Intronic
905598801 1:39232821-39232843 TGCCCAGGCTGGAGTACATTGGG + Intronic
905688135 1:39923525-39923547 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
907217615 1:52878907-52878929 TGCCCAGGCTGGAGTGCAATTGG - Intronic
907363491 1:53941033-53941055 TGCCCAGGCTGGAGTGCAATGGG + Intronic
907538515 1:55188921-55188943 TGTCCAGGCTGGAGTGCAATGGG - Intronic
908352565 1:63300603-63300625 TGCCCAGGCTGCAGTACAATTGG - Intergenic
908743740 1:67355372-67355394 TGCCCAGGCTGGAGTACAAGTGG - Intronic
909167901 1:72252144-72252166 TTTCCAGGCTGGAGTGCAATGGG + Intronic
909268777 1:73596784-73596806 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
909618527 1:77640557-77640579 TGCCCAGGCTGGAGTGCAATGGG - Intronic
909843404 1:80358613-80358635 TGCCCAGGCTAGAGTACAGTGGG - Intergenic
909936310 1:81555306-81555328 TGCCCAGGCTGGAGTACAAATGG + Intronic
910484847 1:87701682-87701704 TGCCCAGGCTAGAGTGCAATGGG - Intergenic
911736486 1:101342548-101342570 TGTCCAGGCTGGAGTGCAATGGG + Intergenic
911943038 1:104071863-104071885 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
912091582 1:106082983-106083005 TGCCCAGGCTGGAGTACAATGGG + Intergenic
912238611 1:107880753-107880775 TGCCCAGGCTGGAGTACAGTGGG - Intronic
914262118 1:146008069-146008091 CGTCCAGGCTGGAGTGCAATGGG + Intergenic
914419910 1:147519814-147519836 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
914714864 1:150246244-150246266 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
914719221 1:150275461-150275483 TTAACAGGCTGGAGTACAGTTGG - Intronic
914726896 1:150335504-150335526 TGCCCAGGCTGGAGTGCAATGGG + Intronic
914828844 1:151156057-151156079 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
915297748 1:154933390-154933412 TGCCCAGGCTGGAGTGCAATGGG - Intronic
915429476 1:155854993-155855015 TGCCCAGGCTGGAGTGCAATGGG - Intronic
915478303 1:156167433-156167455 TGCCCAGGCTGGAGTACAGTGGG - Intronic
915821513 1:159029719-159029741 TGCCCAGGCTGGAGTGCAATGGG + Intronic
916050726 1:161034781-161034803 TGCCCAGGCTGGAGTGCAATGGG - Intronic
916145370 1:161734407-161734429 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
917379309 1:174386546-174386568 TGCCCAGGCTGGAGTGCAATGGG + Intronic
918228371 1:182508338-182508360 TGCCCAGGCTGGAGTGCAATGGG + Intronic
919218179 1:194588281-194588303 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
920423319 1:205851116-205851138 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
920759816 1:208772518-208772540 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
921161774 1:212477885-212477907 TGTCCAGGCTGCAGTGCAATGGG + Intergenic
922513966 1:226192923-226192945 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
923159441 1:231304076-231304098 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
923388846 1:233493343-233493365 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
923624529 1:235603201-235603223 TGTCCAGGCTGGAGTGCAAGTGG - Intronic
923722029 1:236475090-236475112 TGCCCAGGCTGGAGTGCAATGGG - Intronic
923911248 1:238446023-238446045 TGTCCAGGCTGGAGTGCAGTTGG - Intergenic
923921884 1:238575418-238575440 TGCCCAGGCTGGAGCACAATGGG + Intergenic
924192178 1:241565681-241565703 TGTCCAGGCTGGAATGCAATGGG - Intronic
924759805 1:246973088-246973110 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1063454940 10:6176446-6176468 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1064078714 10:12291018-12291040 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1064445483 10:15389071-15389093 TGTTCAGGCTGGAGTGCAGTAGG + Intergenic
1064737111 10:18393166-18393188 CATCCAGGCTGGAGTACAATGGG - Intronic
1064986910 10:21219952-21219974 TGCCCAGGCTGGAGTACCATGGG + Intergenic
1065211996 10:23412904-23412926 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1065291633 10:24236290-24236312 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1065352453 10:24807661-24807683 TGTCCAGGCTGGAGTGCAGTAGG - Intergenic
1065585539 10:27213714-27213736 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1065754841 10:28921896-28921918 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1065770157 10:29070551-29070573 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1065776556 10:29125795-29125817 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1065927096 10:30444420-30444442 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1066231665 10:33440589-33440611 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1066473800 10:35724913-35724935 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1066501238 10:35996894-35996916 TGCCCAGGCTGGAGTGCAATTGG + Intergenic
1066683204 10:37955716-37955738 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1066987201 10:42478020-42478042 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1067020130 10:42789096-42789118 TGTACAGGCGTGTGTAGATTAGG + Intronic
1067105688 10:43364609-43364631 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1067496180 10:46762433-46762455 TGCCCAGGCTGGAGTGCAATCGG + Intergenic
1067598476 10:47577960-47577982 TGCCCAGGCTGGAGTGCAATCGG - Intergenic
1068296296 10:55076808-55076830 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1068409361 10:56635254-56635276 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1068844153 10:61652513-61652535 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1069015180 10:63421291-63421313 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1069035499 10:63642279-63642301 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1069064015 10:63923770-63923792 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1069220162 10:65872865-65872887 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1069472001 10:68701763-68701785 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1069472382 10:68704754-68704776 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1069802080 10:71087977-71087999 TCTAGACACTTGAGTACAATGGG + Intergenic
1069929266 10:71871606-71871628 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1070153735 10:73820711-73820733 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1072589718 10:96818432-96818454 TGCACAGGCTGGAGCGCAATGGG + Intergenic
1073270394 10:102258194-102258216 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1073318284 10:102598191-102598213 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1073475929 10:103753453-103753475 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1073745752 10:106466559-106466581 CGTCCAGGCTGGAGTGCAATGGG - Intergenic
1073752094 10:106540270-106540292 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1073754706 10:106568651-106568673 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1074100986 10:110354828-110354850 TGTCCAGGCCTGAGTGCAACTGG - Intergenic
1074448160 10:113537476-113537498 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1075455513 10:122582387-122582409 TTTATAGACTTGAGTAGAATAGG + Intronic
1075457636 10:122595090-122595112 TTTATAGACTTGAGTAGAATAGG + Intronic
1075458710 10:122601584-122601606 TTTATAGACTTGAGTAGAATAGG + Intronic
1075459341 10:122605643-122605665 TTTATAGACTTGAGTAGAATAGG + Intronic
1075459973 10:122609702-122609724 TTTATAGACTTGAGTAGAATAGG + Intronic
1075460605 10:122613761-122613783 TTTATAGACTTGAGTAGAATAGG + Intronic
1075699935 10:124462552-124462574 AGTCCAGGCTAGAGTACAGTGGG - Intronic
1075774536 10:124972816-124972838 TGCCCAGGCTAGAGTGCAATGGG + Intronic
1076030832 10:127156606-127156628 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1077818467 11:5711954-5711976 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1077940617 11:6837607-6837629 TGCCCAGGCTGGAGTTCAATGGG + Intergenic
1078251115 11:9617346-9617368 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1078314188 11:10278742-10278764 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1079001096 11:16756865-16756887 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1079788547 11:24707092-24707114 TGTACATACTTTAGTAAAATGGG - Intronic
1080465526 11:32493110-32493132 TGTCTAGGCTGGAGTGCAATGGG + Intergenic
1080518291 11:33043192-33043214 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1080624968 11:34020613-34020635 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1081197494 11:40179043-40179065 TGTACAGGCTGGATTGCAGTGGG + Intronic
1081922284 11:46789753-46789775 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1083034586 11:59624870-59624892 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1083064005 11:59904951-59904973 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1083163201 11:60868085-60868107 TCTCCAGGCTTGAGTGCAGTTGG + Intronic
1083350917 11:62028238-62028260 TGCCCAGGCTAGAGTACAGTGGG - Intergenic
1083598110 11:63929388-63929410 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1083835677 11:65265519-65265541 TGCCCAGGCTGGAGTATAATGGG + Intronic
1084336098 11:68458853-68458875 CGCCCAGGCTGGAGTACAATGGG - Intergenic
1084336231 11:68459625-68459647 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
1084799562 11:71533814-71533836 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1085164180 11:74381617-74381639 TGCTCAGGCTGGAGTACAGTGGG + Intronic
1085180325 11:74529718-74529740 AGTACAGGCTGGAGTGCAGTGGG + Intronic
1085214671 11:74818431-74818453 TGTCCAGGCTGGAGTATAATTGG + Intronic
1085926346 11:81027171-81027193 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1086108700 11:83175174-83175196 TGTCCAGGCTGGAGTACAGTGGG + Intronic
1086114196 11:83230090-83230112 TGCCCAGGCTTGAATGCAATGGG + Intronic
1086186346 11:84021796-84021818 TGCCCAGGCTGGAGTGCAATTGG + Intronic
1086369959 11:86146606-86146628 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1086480197 11:87227006-87227028 TGCCCAGGCTGGAGTACACTGGG - Intronic
1087436314 11:98123286-98123308 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1087754722 11:102042817-102042839 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1088199542 11:107316892-107316914 TGTCCAGGCTAAAGTACAATGGG + Intergenic
1088270459 11:108028781-108028803 TGCCCAGGCTGGAGTACAATGGG - Intronic
1088476522 11:110245391-110245413 TGCACAGGCTGGAGTGCAGTGGG - Intronic
1088630916 11:111773283-111773305 TGCCCAGGCTGTAGTACAATGGG + Intergenic
1088639903 11:111862272-111862294 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1089247342 11:117131776-117131798 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1090040681 11:123288564-123288586 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1090759122 11:129820273-129820295 TGTCCAGGCTGGAGTGCAAGTGG - Intronic
1091125603 11:133092683-133092705 TGTTCAGGCTGGAGTGCAGTGGG - Intronic
1091136374 11:133194248-133194270 TGCCCAGGCTGGAGTGCAATAGG + Intronic
1091352659 11:134909619-134909641 TGTACAGGTTTAAGTAGAAGAGG - Intergenic
1091746552 12:2996447-2996469 TGCCCAGGCTAGAGTGCAATGGG + Intronic
1092500794 12:9044624-9044646 TGCCCAGGCTGGAGTGCAATAGG - Intergenic
1092632001 12:10391154-10391176 TGTCCAGGCTGGAGTGCAACGGG + Intronic
1092654198 12:10667587-10667609 TGCTCAGGCTGGAGTACAGTGGG - Intronic
1092697056 12:11183716-11183738 CGTCCAGGCTGGAGTACAGTGGG - Intergenic
1092741863 12:11637947-11637969 TGTCCAGGCTGAAGTGCAATGGG - Intergenic
1093140942 12:15509644-15509666 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1093849529 12:24018755-24018777 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1094196398 12:27754211-27754233 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1094651873 12:32386560-32386582 TGCTCAGGCTGGAGTACAATGGG + Intergenic
1095560934 12:43563961-43563983 CGCCCAGGCTGGAGTACAATGGG - Intergenic
1095994853 12:48072575-48072597 TGCTCAGGCTGGAGTACAGTGGG - Intronic
1096067476 12:48752710-48752732 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1096171366 12:49473374-49473396 TGCTCAGGCTGGAGTACAGTGGG - Intronic
1096479121 12:51926292-51926314 TCGACAGGCTTGGGTATAATGGG + Intergenic
1096721648 12:53527440-53527462 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1097108675 12:56641320-56641342 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1097120546 12:56728283-56728305 TGCCCAGGCTAGAGTACAGTGGG + Intronic
1097662678 12:62447752-62447774 TGCCCAGGCTGGAGTATAATGGG + Intergenic
1098864190 12:75743480-75743502 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1099270745 12:80507115-80507137 TGTACAGGCTTCTGCATAATTGG + Intronic
1099367720 12:81790075-81790097 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1099993483 12:89752193-89752215 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1100402770 12:94246608-94246630 TGTAGAGTCTTGAGGATAATAGG + Intronic
1101104214 12:101424046-101424068 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1101698425 12:107148824-107148846 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1102075920 12:110060183-110060205 TGCACAGGCTGGAGTGTAATGGG - Intronic
1102193426 12:111006628-111006650 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1102505137 12:113379769-113379791 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1103441970 12:120969859-120969881 TCCCCAGGCTGGAGTACAATGGG + Intergenic
1103512842 12:121487098-121487120 TGCCCAGGCTGGAGTACAAGTGG - Intronic
1103684953 12:122724698-122724720 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
1103833776 12:123802344-123802366 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1103865850 12:124051441-124051463 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1104318737 12:127729489-127729511 TGTACATTCTTGAGTTCAAGAGG - Intergenic
1104620704 12:130310594-130310616 TGTACTAGTTTGGGTACAATCGG + Intergenic
1104672726 12:130691628-130691650 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1104710932 12:130985589-130985611 TGTCCAGGCTGGAGTGCAATGGG + Intronic
1105219066 13:18308711-18308733 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1105241949 13:18616172-18616194 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1105361990 13:19727351-19727373 CGTTCAGGCTGGAGTGCAATGGG - Intronic
1105572341 13:21614710-21614732 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1105659560 13:22478765-22478787 TGTACATGCTTGAGATCACTGGG - Intergenic
1105726594 13:23168559-23168581 AGTACAGGCTTGAGGACAGTTGG + Intergenic
1106130418 13:26934828-26934850 TGTACAGGCTGCAGAACCATAGG + Intergenic
1106177758 13:27345849-27345871 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1106365126 13:29071464-29071486 TGCCCAGGCTGGAGTAAAATTGG + Intronic
1107145660 13:37058222-37058244 TGTCCAGGCTGGAGTGCAATGGG - Intronic
1107339657 13:39392551-39392573 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1107472015 13:40699536-40699558 TGCCCAGGCTTGAGTGCAGTGGG - Intergenic
1107481710 13:40790626-40790648 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1107521055 13:41181674-41181696 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1108393454 13:49970957-49970979 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1108502552 13:51081334-51081356 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1108684597 13:52807787-52807809 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1109437043 13:62317185-62317207 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1109790558 13:67241990-67242012 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1111626930 13:90799629-90799651 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1112026905 13:95419541-95419563 TGCCCAGGCTTGAGTGCAGTGGG - Intergenic
1112066753 13:95801148-95801170 CGCCCAGGCTTGAGTGCAATGGG + Intergenic
1112887102 13:104188035-104188057 TGCCCAGGCTGGAGTGCAATAGG + Intergenic
1113316164 13:109181859-109181881 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1113472038 13:110554072-110554094 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1113724304 13:112587365-112587387 TTAACAGGCTTGAGTATTATGGG - Intronic
1115001324 14:28423065-28423087 TGCCCAGGCTGGAGTACAGTTGG - Intergenic
1115604739 14:34989426-34989448 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1116628322 14:47295862-47295884 CGTCCAGGCTTGAGTGCAAGTGG - Intronic
1116870997 14:50069060-50069082 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1117530729 14:56658286-56658308 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1117642964 14:57819770-57819792 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1117964679 14:61194772-61194794 CGCCCAGGCTTGAGTGCAATGGG + Intronic
1118121042 14:62843450-62843472 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1118791150 14:69094265-69094287 TCTACAGGCCTGACTAGAATGGG - Intronic
1118856667 14:69628759-69628781 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1119167486 14:72507126-72507148 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1119231666 14:72984767-72984789 GTTACAGTATTGAGTACAATGGG - Intronic
1119273055 14:73326584-73326606 TGCCCAAGCTGGAGTACAATGGG - Intronic
1119326741 14:73764297-73764319 TGCCCAGGCTAGAGTACAGTGGG - Intronic
1119723542 14:76907854-76907876 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1120544011 14:85787333-85787355 TCTTCAGGCTTTAGTAGAATTGG + Intergenic
1120875116 14:89368287-89368309 TATCCAGGCTGGAGTGCAATGGG - Intronic
1121082285 14:91118119-91118141 TGTCCAGGCTAGAGTACAGTGGG + Intronic
1121613536 14:95297498-95297520 GGAAGAGGATTGAGTACAATAGG - Intronic
1121696762 14:95919670-95919692 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1121722513 14:96120034-96120056 TCTACAGGCTTGATTAGATTTGG + Intergenic
1121809419 14:96868841-96868863 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1122250020 14:100431585-100431607 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1122293083 14:100689910-100689932 TGCCCAGGCTGGAGCACAATGGG + Intergenic
1122590129 14:102843375-102843397 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1122709453 14:103645012-103645034 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1202874830 14_GL000225v1_random:197709-197731 TGGAAAGGATTGAATACAATGGG + Intergenic
1123727539 15:23119278-23119300 TGCCCAGGCTGGAGTACAGTTGG - Intergenic
1123776117 15:23582298-23582320 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1124013149 15:25855016-25855038 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1124124150 15:26922799-26922821 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1124415296 15:29468567-29468589 TGCGCAGGCTGGAGTACAATGGG - Intronic
1124587315 15:31021653-31021675 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1125289875 15:38134233-38134255 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1125619305 15:41045539-41045561 CGCCCAGGCTGGAGTACAATGGG - Intronic
1125652580 15:41329740-41329762 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1125958216 15:43805996-43806018 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1126139552 15:45426072-45426094 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
1126181054 15:45785448-45785470 TGCCCAGGCTGGAGTGCAATAGG + Intergenic
1126602291 15:50440958-50440980 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1126627076 15:50695416-50695438 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1126763349 15:51989638-51989660 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1127089024 15:55448457-55448479 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1127127127 15:55822596-55822618 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1127518322 15:59717711-59717733 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1128130071 15:65221154-65221176 TGTCCAGGCTGGAGTACAAGTGG + Intergenic
1128189395 15:65677249-65677271 TTTCCAGGCTGGAGTACAGTGGG + Intronic
1128274354 15:66340216-66340238 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1128721092 15:69948903-69948925 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1129024557 15:72558339-72558361 TGCCCAGGCTGGAGTACAAGTGG + Intronic
1129025653 15:72571086-72571108 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1129040770 15:72684526-72684548 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1129121070 15:73397020-73397042 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1130106914 15:80935770-80935792 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1130299615 15:82670025-82670047 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1130375556 15:83325949-83325971 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
1130556933 15:84929501-84929523 TGCTCAGGCTGGAGTGCAATGGG - Intronic
1130557723 15:84934651-84934673 TATACAGGGTTAAGTAAAATCGG - Intronic
1131039429 15:89249386-89249408 TGCACAGGCTGGAGTGCAGTGGG + Intronic
1131538746 15:93258514-93258536 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1133024345 16:2981216-2981238 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1133248087 16:4462435-4462457 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1133275022 16:4633040-4633062 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1133309413 16:4834339-4834361 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1133549564 16:6840844-6840866 CGCCCAGGCTAGAGTACAATGGG - Intronic
1134151446 16:11808339-11808361 TGTCCAGGCTGGAGTATAGTGGG - Intergenic
1134308789 16:13057433-13057455 AGTCCAGGCTGGAGTGCAATGGG + Intronic
1134315271 16:13113167-13113189 TGTCCAGGCTGGAGTACAGCAGG - Intronic
1134321321 16:13167111-13167133 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1134505453 16:14802333-14802355 TGCCCAGGCTAGAGTACAGTGGG - Intronic
1134511328 16:14850109-14850131 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1134698972 16:16248606-16248628 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1134727320 16:16429915-16429937 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1134841083 16:17402277-17402299 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1134857758 16:17534967-17534989 TGTACAGACCTGTGTACAAAGGG + Intergenic
1134972865 16:18546067-18546089 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1135312573 16:21417753-21417775 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1135346765 16:21695343-21695365 TGTCCAGGCTGGAGTGCAGTTGG - Intronic
1135365521 16:21850218-21850240 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1135446318 16:22521130-22521152 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1135909465 16:26545949-26545971 TGTTCAGGCTGGAGTGCAGTGGG - Intergenic
1135922070 16:26659990-26660012 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1136151749 16:28355715-28355737 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1136167982 16:28469555-28469577 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1136194992 16:28645456-28645478 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1136211331 16:28759568-28759590 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1136256052 16:29039523-29039545 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1136266730 16:29125660-29125682 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1136309275 16:29396718-29396740 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1136314129 16:29440582-29440604 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1136322693 16:29498257-29498279 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1136327568 16:29542347-29542369 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1136437375 16:30238229-30238251 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1136442257 16:30282347-30282369 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1136931622 16:34423003-34423025 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1136972950 16:34988812-34988834 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1137041200 16:35614542-35614564 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1137322030 16:47393688-47393710 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1137361749 16:47823511-47823533 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1138570805 16:57871114-57871136 TGTCCAAGCTAGAGTACAGTGGG - Intergenic
1138649872 16:58453745-58453767 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1139404274 16:66706018-66706040 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1139587598 16:67914188-67914210 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1139626219 16:68191019-68191041 TGAAAAGGCTGGTGTACAATTGG - Exonic
1139856970 16:69989136-69989158 TGTCCAGGCTGGAGTGCAATGGG - Intergenic
1139889064 16:70236070-70236092 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1139904334 16:70353161-70353183 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1139913295 16:70411951-70411973 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1140211184 16:72971924-72971946 TGCCCAGGTTGGAGTACAATGGG + Intronic
1140282416 16:73566733-73566755 TGTCCAGGCTGGAGCGCAATGGG + Intergenic
1140365742 16:74378839-74378861 TGTCCAGGCTGGAGTGCAATGGG + Intronic
1140435247 16:74941649-74941671 CGTCCAGGCTGGAGTACAGTGGG - Intronic
1140445145 16:75021079-75021101 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1141170834 16:81690542-81690564 TGTCCAGGCTAGAGTGCAGTGGG + Intronic
1141176372 16:81722328-81722350 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1142378457 16:89718753-89718775 GTTCCAGGCTGGAGTACAATGGG + Intronic
1142654433 17:1381870-1381892 CGTGCAGGCTGGAGTACAGTGGG - Intronic
1142785814 17:2221782-2221804 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1142796178 17:2309075-2309097 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1143085858 17:4415680-4415702 TGCCCAGGCTGGAGTACAATGGG + Intergenic
1143268906 17:5661273-5661295 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1144121760 17:12161553-12161575 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1144123777 17:12182176-12182198 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1144183718 17:12776262-12776284 TGCCCAGGCTAGAGTGCAATAGG + Intergenic
1144214553 17:13043804-13043826 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1144962067 17:19050069-19050091 TGCCCAGGCTGGAGTATAATGGG - Intergenic
1144973094 17:19124453-19124475 TGCCCAGGCTGGAGTATAATGGG + Intergenic
1145082585 17:19907449-19907471 TGTCCAGGCTGGAGTACAAGTGG + Intronic
1145253194 17:21307716-21307738 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1145918110 17:28588721-28588743 TGCCCAGGCTAGAGTACACTGGG + Intronic
1145937427 17:28723072-28723094 TGCTCAGGCTGGAGTACAATGGG - Intronic
1145957784 17:28866591-28866613 TGCCCAGGCTGGAGTACAATAGG - Intergenic
1146312171 17:31777724-31777746 TGTCCAGGCTGGAGTACAGTGGG - Intergenic
1146598756 17:34193222-34193244 TGCCCAGGCTGGAGTACAACGGG + Intergenic
1146911116 17:36649165-36649187 TGCACAGGCTGGAGTGCAGTAGG + Intergenic
1146937525 17:36821589-36821611 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1147596314 17:41720234-41720256 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1147634451 17:41954807-41954829 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1147860931 17:43522704-43522726 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1148001069 17:44387480-44387502 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1148183886 17:45627389-45627411 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1148264851 17:46217433-46217455 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1148494102 17:48042172-48042194 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1148617166 17:49009666-49009688 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1148663445 17:49355856-49355878 TGCCCAGGCTTCAGTACAAATGG - Intronic
1148670938 17:49409580-49409602 TGCCTAGGCTGGAGTACAATGGG + Intronic
1149474088 17:56944548-56944570 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1149689553 17:58563030-58563052 TGCCCAGGCTGGAGTGCAATAGG - Intronic
1149758351 17:59206993-59207015 TGCTCAAGCTGGAGTACAATGGG - Intronic
1149893570 17:60411281-60411303 TGCCCAGGCTGGAGTGCAATCGG - Intronic
1150112244 17:62512260-62512282 TGCCCAGGCTGGAGTACAAATGG + Intronic
1150585653 17:66515581-66515603 TGCCCAGGCTTGAGTGCAGTGGG + Intronic
1150675062 17:67237945-67237967 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1150725226 17:67646083-67646105 TGCCCAGGCTGGAGTACAAATGG - Intronic
1151248739 17:72817151-72817173 TGTACAGGCTTCAGAACCATTGG - Intronic
1151778779 17:76227834-76227856 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1151798123 17:76360279-76360301 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1152072309 17:78139999-78140021 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1152174298 17:78777082-78777104 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1152711761 17:81874405-81874427 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1152815983 17:82408100-82408122 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1153054346 18:931136-931158 TGTCCAGGCTGGAGTGCAATGGG + Intergenic
1153305594 18:3627916-3627938 TGTCCAGGCCGGAGTGCAATGGG + Intronic
1154118454 18:11632420-11632442 TGTCCAGGCTGGAGTGCAATGGG - Intergenic
1154166412 18:12017980-12018002 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1154245900 18:12698267-12698289 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1154447002 18:14443706-14443728 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1155156999 18:23166240-23166262 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1155255860 18:23997509-23997531 TGCCCAGGCTGGAGTACAGTTGG - Intronic
1155485051 18:26332568-26332590 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1155662191 18:28262899-28262921 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1155973445 18:32103222-32103244 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1156299219 18:35820943-35820965 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1157221529 18:45831776-45831798 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1157233653 18:45942561-45942583 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1158245843 18:55431318-55431340 TGTCCAGGCTAGAGTGCAATGGG + Intronic
1159061368 18:63518024-63518046 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1159339430 18:67116831-67116853 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1159799947 18:72885810-72885832 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1160286221 18:77546315-77546337 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1161203829 19:3029835-3029857 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1161671721 19:5615659-5615681 TGTGCAGGCTGGAGTGCAGTGGG - Intronic
1161908328 19:7174249-7174271 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1161930787 19:7338254-7338276 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1161946773 19:7442275-7442297 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1162090761 19:8278335-8278357 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1162092994 19:8293169-8293191 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1162264929 19:9564335-9564357 TGTTCATGCTGGAGTACAAGTGG - Intronic
1162432727 19:10638838-10638860 TGCCCAGGCTGGAGTGCAATAGG + Intronic
1162816029 19:13195208-13195230 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1162946033 19:14044278-14044300 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1163601099 19:18249612-18249634 TGCCCAGGCTGGAGTACAATGGG + Intronic
1163795048 19:19333034-19333056 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1163859025 19:19730869-19730891 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1163999383 19:21083076-21083098 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1164104796 19:22100039-22100061 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1164950097 19:32329885-32329907 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
1165462760 19:35953745-35953767 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1165597920 19:37026359-37026381 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1165650610 19:37485446-37485468 TGCCCAGGCTGGAGTACAGTGGG + Exonic
1165801714 19:38555902-38555924 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1165886275 19:39081195-39081217 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1165889866 19:39105053-39105075 TGCCCAGGCTGGAGTGCAATTGG + Intronic
1166217855 19:41347785-41347807 CGCCCAGGCTGGAGTACAATGGG - Intronic
1166220238 19:41359660-41359682 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1166224347 19:41385854-41385876 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1166450172 19:42891963-42891985 TGCCCAGGCTAGAGTACAGTGGG - Intronic
1166462063 19:42996254-42996276 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1166479333 19:43156224-43156246 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1166501853 19:43347371-43347393 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1166508266 19:43386070-43386092 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1167155742 19:47737749-47737771 TGTCCAGGCTGGAGTGCAATGGG + Intronic
1167202421 19:48075222-48075244 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1167242007 19:48349603-48349625 TGTCCAGGCTGGAGTGCAGTTGG - Intronic
1167388075 19:49176266-49176288 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1167449617 19:49559467-49559489 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1167621354 19:50562778-50562800 CGTCTAGGCTGGAGTACAATGGG + Intronic
1167897015 19:52590139-52590161 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1167985381 19:53309994-53310016 CGCCCAGGCTGGAGTACAATGGG - Intergenic
1168017351 19:53584104-53584126 TGTCCAGGCTGGAGTGCAATGGG - Intergenic
1168127892 19:54297035-54297057 TGTCCAGGCTGGAATGCAATGGG - Intergenic
1168222717 19:54972513-54972535 TGCTCAGGCTGGAGTACAATGGG + Intronic
1168630530 19:57952825-57952847 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
924971589 2:132886-132908 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
925653977 2:6124811-6124833 TGCTCAGGCTGGAGTGCAATGGG - Intergenic
926516661 2:13854587-13854609 TGCACAGGCTGGAGTGCAAGTGG - Intergenic
926753490 2:16218171-16218193 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
927081745 2:19637134-19637156 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
927785756 2:25973511-25973533 TGCCCAGGCTGGAGTACAGTGGG - Intronic
928145996 2:28776301-28776323 TGCCCAGGCTGGAGTGCAATGGG + Intronic
928506194 2:31955647-31955669 TGCCCAGGCTGGAGTGCAATGGG + Intronic
928509725 2:31991528-31991550 TGCCCAGGCTGGGGTACAATGGG - Intronic
928671350 2:33606750-33606772 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
929503709 2:42511672-42511694 TGCCCAGGCTGGAGTACAACGGG - Intronic
929612446 2:43281480-43281502 TGCCCAGGCTGGAGTGCAATGGG + Intronic
929868682 2:45739698-45739720 GGTACAAGATTGAGTACAAAGGG + Intronic
929938996 2:46316297-46316319 TGCACAGACTGGAGTGCAATGGG + Intronic
930074162 2:47392844-47392866 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
930126537 2:47802371-47802393 TTTTCAGACTGGAGTACAATGGG + Intronic
930335428 2:50039134-50039156 TGCTCAGGCTGGAGTACAGTGGG - Intronic
930819248 2:55629144-55629166 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
930824547 2:55682867-55682889 TGCCCAGGCTGGAGTACAGTTGG - Intronic
930996286 2:57722222-57722244 CATCCAGGCTGGAGTACAATGGG - Intergenic
931314117 2:61110805-61110827 TGCCCAGGCTGGAGTGCAATGGG - Intronic
931337740 2:61365209-61365231 TGCCCAGGCTGGAGTGCAATGGG - Intronic
931358597 2:61558727-61558749 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
931359424 2:61565625-61565647 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
931365197 2:61613210-61613232 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
931383678 2:61777326-61777348 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
931384578 2:61786524-61786546 TGTCCAGGCTAGAGTGCAGTGGG - Intergenic
931411407 2:62035697-62035719 TGCACAGGCTGGAGTGCAGTTGG - Intronic
931587487 2:63843923-63843945 TGTCCACGCTGGAGTACAGTGGG + Intronic
931688428 2:64814814-64814836 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
931733480 2:65174000-65174022 TGCCCAGGCTTGAGTACAGTGGG + Intergenic
933667912 2:84979480-84979502 TGCTCAGGCTGGAGTGCAATGGG - Intronic
933752964 2:85615059-85615081 TGCCCAGGCTGGAGTGCAATGGG + Intronic
933755315 2:85633724-85633746 TGTCCAGGCTGGAGTACAGTGGG - Intronic
933786066 2:85842800-85842822 TGCCCAGGCTGGAGTGCAATGGG + Intronic
934184990 2:89663810-89663832 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
934295259 2:91737923-91737945 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
934733137 2:96672117-96672139 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
934785154 2:96999701-96999723 TGCCCAGGCTGGAGTGCAATGGG - Intronic
934864515 2:97794105-97794127 TGCCCAGGCTGGAGTGCAATGGG + Intronic
935172602 2:100622113-100622135 TGCCCAGGCTGGAGTGCAATTGG + Intergenic
935319751 2:101874566-101874588 TGTACACTATTGAGTATAATGGG - Intronic
935458768 2:103302705-103302727 TGTTCAGGCTGGAGTGCAATGGG + Intergenic
935919493 2:107996607-107996629 TGTATAGTTTTGAGAACAATAGG + Intronic
936707054 2:115087591-115087613 TGCACAGGCTGGAGTGCAATTGG + Intronic
937368467 2:121281970-121281992 TGTCCAGGCTGGAGTGCAAGTGG + Intronic
937774781 2:125763257-125763279 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
938286865 2:130126260-130126282 TGCCCAGGCTGGAGTGCAATGGG - Intronic
938414872 2:131095854-131095876 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
938428730 2:131212603-131212625 TGCCCAGGCTGGAGTGCAATGGG + Intronic
938469632 2:131546636-131546658 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
938863282 2:135392271-135392293 TGTCCAGGCTGGAGTACAGTGGG - Intronic
939090673 2:137776590-137776612 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
939132444 2:138253394-138253416 TGCTCAGGCTGGAGTGCAATGGG + Intergenic
940207902 2:151224531-151224553 TGCCCAGGCTGGAGTACAGTTGG + Intergenic
941426739 2:165355956-165355978 TGCCCAGGCTGGAGTGCAATGGG - Intronic
942338096 2:174912992-174913014 TGTAAAGCCATGAGTAGAATGGG + Intronic
944089039 2:195884043-195884065 TATACAGATTTAAGTACAATTGG - Intronic
944111963 2:196142093-196142115 TGCCCAGGCTGGAGTACAAATGG + Intronic
944559496 2:200921675-200921697 TGTCCAGGCTAGAGTGCAGTGGG + Intronic
944713462 2:202356833-202356855 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
944736542 2:202571933-202571955 TGCCCAGGCTGGAGTACAAGAGG - Intergenic
944745198 2:202648800-202648822 TGTCCAGGCTGGAGTGCAGTTGG + Intronic
944762242 2:202828221-202828243 TGCCCAGGCTGGAGTGCAATGGG - Intronic
944769464 2:202899081-202899103 TGCCCAGGCTTGAGTGCAGTGGG + Intronic
944819934 2:203419945-203419967 TGCCCAGGCTGGAGTGCAATGGG - Intronic
944899547 2:204200100-204200122 TGCTCAGGCTGGAGTACAGTGGG - Intergenic
944999128 2:205329951-205329973 TGTCCAGGCTAGAGTGCAATGGG - Intronic
945118373 2:206432508-206432530 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
945243744 2:207699515-207699537 TGCCCAGGCTTGAGTGCAATGGG + Intergenic
945501224 2:210578147-210578169 TGCCCAGGCTGGAGTGCAATGGG + Intronic
946721560 2:222614293-222614315 TGCACAGGATGGAGTGCAATGGG + Intronic
946843623 2:223840150-223840172 CGTCCAGGCTGGAGTACAGTGGG - Intergenic
947009909 2:225553977-225553999 AGTCCAGGCTGGAGTGCAATGGG - Intronic
947210230 2:227701579-227701601 TGTGCAGGCTAGAGTGCAACGGG - Intronic
947599204 2:231435007-231435029 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
947635387 2:231678172-231678194 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
947639870 2:231701279-231701301 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1168819950 20:765976-765998 AGTCCAGGCTGGAGTGCAATGGG + Intronic
1169265518 20:4165093-4165115 TGTCCAGGCTAGAGTGCAGTGGG + Intronic
1169379091 20:5091259-5091281 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1169416448 20:5421010-5421032 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1169591734 20:7150542-7150564 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1169681653 20:8220883-8220905 TGTCCTGGCATCAGTACAATTGG + Intronic
1170267443 20:14483445-14483467 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1170653096 20:18260808-18260830 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1172002692 20:31792316-31792338 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1172095758 20:32459422-32459444 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1172405346 20:34684323-34684345 TGTCCAGGCTGCAGTACAAATGG - Intergenic
1172805463 20:37608713-37608735 CGTCCAGGCTGGAGTGCAATGGG + Intergenic
1172817217 20:37697140-37697162 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1173796158 20:45861613-45861635 TGCCCAGGCTAGAGTACAGTGGG + Intronic
1173925268 20:46776611-46776633 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1174026451 20:47580515-47580537 TGCACAGGCTAGAGTGCAGTGGG - Intronic
1174235811 20:49090513-49090535 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1174343320 20:49911624-49911646 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1174605428 20:51757859-51757881 TGCTCAGGCTGGAGTACAGTGGG - Intronic
1174816732 20:53693611-53693633 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1175371204 20:58494376-58494398 CGCATAGGCTAGAGTACAATGGG + Intronic
1175523078 20:59615268-59615290 TGTACAGGTTTCAGTGAAATGGG + Intronic
1175616654 20:60405477-60405499 TGTGCAGAATTGAGTACCATTGG - Intergenic
1175824019 20:61926830-61926852 TGCCCAGGCTTGAGTTCAATGGG - Intronic
1176448971 21:6846129-6846151 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1176827141 21:13711152-13711174 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1177165588 21:17599515-17599537 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1177286777 21:19061992-19062014 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1177413549 21:20764232-20764254 TGTACAGTTTTGAATACAAGTGG - Intergenic
1177814824 21:25964648-25964670 TATACAGGCTGGAGTACAATGGG + Intronic
1178349094 21:31858963-31858985 TATCCAGGCTGGAGTGCAATGGG + Intergenic
1178827373 21:36028144-36028166 TGCTCAGGCTGGAGTGCAATGGG - Intergenic
1179276909 21:39900073-39900095 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1179625653 21:42648001-42648023 TGCTCAGGCTTGAGTGCAATGGG - Intergenic
1179837255 21:44044702-44044724 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1179907296 21:44429326-44429348 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1180077527 21:45470525-45470547 TGCTCAGGCTGGAGTGCAATGGG + Intronic
1180153613 21:45966182-45966204 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1181135709 22:20764816-20764838 TGTACCGGCTGGAGTACATGAGG - Exonic
1181565081 22:23731538-23731560 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
1181619071 22:24075703-24075725 TGCCCAGGCTGGAGTACAGTTGG - Intronic
1182004430 22:26947666-26947688 TGTTCAGGCTTGCACACAATAGG - Intergenic
1182141029 22:27958440-27958462 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1182338665 22:29602307-29602329 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1182496153 22:30709056-30709078 TGTCCAGGCTAGAGTGCAACAGG - Intronic
1182590777 22:31377953-31377975 TGCCCAGGCTTGAGTGCAAAGGG + Intergenic
1183016784 22:34995114-34995136 TACAAAGGCTTGAGTACCATGGG + Intergenic
1183638337 22:39078216-39078238 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1184270601 22:43379927-43379949 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1184467897 22:44679663-44679685 TGCCCAGGCTGGAGTGCAATGGG - Exonic
1184564190 22:45281968-45281990 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1184576991 22:45377594-45377616 TGCCCAGGCTAGAGTACAGTGGG - Intronic
949731920 3:7123576-7123598 TGCCCAGGCTGGAGTACAGTGGG - Intronic
951203911 3:19905209-19905231 TGCTCAGGCTGGAGTACAGTAGG - Intronic
951475101 3:23096835-23096857 TGCCCAGGCTGGAGTACAATGGG + Intergenic
951879984 3:27471443-27471465 TGCTCAGGCTGGAGTGCAATGGG + Intronic
952396495 3:32925445-32925467 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
953000082 3:38924412-38924434 TGCCCAGGCTGGAGTGCAATGGG + Intronic
953304009 3:41809123-41809145 TGCACAGGCTGGAGTGCAGTGGG - Intronic
953321012 3:41971497-41971519 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
953636163 3:44666900-44666922 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
954023956 3:47767278-47767300 TGCCCAGGCTGGAGTGCAATGGG + Intronic
954319881 3:49824838-49824860 TGTCCAGGCTGGAGTGCAATTGG - Intergenic
954345478 3:49994102-49994124 TGTTCAGGCTGGAGTGCAGTAGG + Intronic
954557305 3:51528232-51528254 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
955087058 3:55713249-55713271 TGCCCAGGCTGGAGTGCAATGGG + Intronic
955170689 3:56562079-56562101 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
955311855 3:57895901-57895923 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
955421368 3:58741535-58741557 TGCCCAGGCTGGAGTACAGTGGG + Intronic
955766370 3:62348406-62348428 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
956431769 3:69193465-69193487 TGCCCAGGCTGGAGTGCAATGGG - Intronic
956514256 3:70028909-70028931 TGTACCTGCTTGAGTTCAGTGGG - Intergenic
956754394 3:72370800-72370822 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
956980702 3:74633924-74633946 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
957157778 3:76567853-76567875 TGCCCAGGCTGGAGTGCAATGGG + Intronic
957355838 3:79084454-79084476 TGCCCAGGCTGGAGTGCAATGGG - Intronic
958427185 3:93992831-93992853 TGCCCAGGCTGGAGTACAAGTGG + Intronic
958519702 3:95168944-95168966 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
958770824 3:98423274-98423296 TCTACAAGCTTGAGGACATTGGG + Intergenic
958954605 3:100453546-100453568 TGCCCAGGCTGGAGTACAATGGG - Intronic
959963233 3:112324762-112324784 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
960650422 3:119942337-119942359 TGCCCAGGCTGGAGTACAATGGG + Intronic
960782224 3:121331757-121331779 TGTTCAGGCTTCAGTCCAGTAGG - Intronic
960877314 3:122309863-122309885 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
961077202 3:123993083-123993105 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
961482038 3:127188014-127188036 AGTACAGCCTTGAATAGAATTGG + Intergenic
962000302 3:131288491-131288513 TGCCCAGGCTGGAGTGCAATGGG + Intronic
962492278 3:135906307-135906329 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
962547299 3:136449932-136449954 TGCACAGGCTGGAGTACAAATGG + Intronic
962981042 3:140490313-140490335 TGTACAGCCCTGACTCCAATAGG - Intronic
963310478 3:143704949-143704971 TGCCCAGGCTGGAGTGCAATGGG - Intronic
963813206 3:149800698-149800720 CGCACAGGCTGGAGTACAGTGGG + Intronic
964219420 3:154326703-154326725 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
964344119 3:155738744-155738766 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
965610972 3:170543600-170543622 TGCCCAGGCTGGAGTGCAATGGG - Intronic
966185078 3:177219932-177219954 TGCCCAGGCTGGAGTACAGTCGG - Intergenic
966254464 3:177901071-177901093 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
966641602 3:182197554-182197576 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
966899177 3:184467997-184468019 TCTCCAGGCTGGAGTGCAATGGG - Intronic
966923238 3:184628088-184628110 TGCCCAGGCTGGAGTGCAATGGG - Intronic
966987358 3:185193472-185193494 TCTGCAGGCTTGGGAACAATGGG - Exonic
967030287 3:185599848-185599870 TGCCCAGGCTGGAGTGCAATAGG + Intronic
967132609 3:186486342-186486364 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
967567856 3:190992523-190992545 TGTACAGGTTAGAGTAGAAGTGG + Intergenic
967727321 3:192873741-192873763 TCAACAGGCTGGAGTACAGTGGG + Intronic
967880706 3:194299327-194299349 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
967935832 3:194726744-194726766 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
968154886 3:196372380-196372402 TGCCCAGGCTAGAGTACAGTGGG + Intronic
968346116 3:198010486-198010508 TGCCCAGGCTTGAGTACAATGGG + Intronic
969035568 4:4250638-4250660 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
969291825 4:6245121-6245143 TGTAAATTGTTGAGTACAATGGG - Intergenic
969375049 4:6757489-6757511 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
969656703 4:8502969-8502991 AGCACAGGCTTGAATACCATCGG + Intergenic
969993979 4:11292880-11292902 TGCCCAGGCTGGAGTGCAATAGG + Intergenic
970469133 4:16358589-16358611 CGCCCAGGCTGGAGTACAATAGG + Intergenic
970514037 4:16809886-16809908 TCTACAGGCTTTAATACACTCGG + Intronic
970603893 4:17661510-17661532 TGCCCAGGCTGGAGTGCAATAGG - Intronic
970739772 4:19221974-19221996 TGACCAGGCTGGAGTGCAATGGG - Intergenic
971219943 4:24695884-24695906 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
972271350 4:37513046-37513068 TGCCCAGGCTGGAGTGCAATTGG - Intronic
972324642 4:38003826-38003848 TGCCCAGGCTGGAGTATAATGGG - Intronic
972325485 4:38011310-38011332 TGCCCAGGCTGGAGTGCAATGGG - Intronic
972501078 4:39678420-39678442 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
972525018 4:39901306-39901328 TGCCCAGGCTGCAGTACAATGGG + Intronic
972650881 4:41016608-41016630 TGCCCAGGCTGGAGTGCAATGGG - Intronic
972782136 4:42295294-42295316 TGTGCAGGCTGGAGTGCAATGGG + Intergenic
972851097 4:43051989-43052011 TGTACAGGCTGGAGTGCAGTGGG + Intergenic
972914244 4:43856553-43856575 CCTCCAGGCTGGAGTACAATGGG + Intergenic
973819069 4:54646775-54646797 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
973880330 4:55265094-55265116 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
974103362 4:57441239-57441261 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
974251921 4:59395614-59395636 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
974822438 4:67084324-67084346 TTTAGAGGCCTGAGTAGAATTGG - Intergenic
974888167 4:67846944-67846966 TGCCCAGGCTGGAGTGCAATGGG + Intronic
975325826 4:73057708-73057730 TGTCCAGGCTGGAGTGCAATGGG + Exonic
975327701 4:73078495-73078517 TGCTCAGGCTGGAGTGCAATGGG - Intronic
976563388 4:86527269-86527291 TGCTCAGGCTGGAGTACAGTGGG - Intronic
976735956 4:88309736-88309758 TGCCCAGGCTGGAGTTCAATGGG + Intergenic
977690802 4:99907635-99907657 TGCCCAGGCTGGAGTACACTGGG - Intronic
978093337 4:104744864-104744886 TGTCTAGGCTGGAGTGCAATGGG + Intergenic
978447921 4:108798664-108798686 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
978693424 4:111545058-111545080 ACTACAGGCTTGAGTTCAAGAGG - Intergenic
978806427 4:112805620-112805642 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
978871302 4:113581470-113581492 TGGCCAGGCTGGAGTGCAATGGG - Intronic
979089109 4:116455423-116455445 TGTACATGCATGAGCACAGTGGG - Intergenic
979200243 4:117969119-117969141 TGTCCAGGCTAGAGTGCAGTGGG + Intergenic
980119172 4:128709891-128709913 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
980372404 4:131893176-131893198 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
980854047 4:138417628-138417650 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
980946168 4:139322730-139322752 TGCCCAGGCTGGAGTGCAATAGG + Intronic
980947408 4:139335798-139335820 TGCCCAGGCTGGAGTGCAATGGG + Intronic
981006846 4:139883928-139883950 TGCCCAGGCTGGAGTGCAATGGG + Intronic
981198391 4:141947336-141947358 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
981262211 4:142734684-142734706 TGCCCAGGCTGGAGTGCAATAGG + Intronic
981470213 4:145125425-145125447 TGCCCAGGCTGGAGTACAGTGGG - Intronic
981992234 4:150935133-150935155 TGACCAGGCTGGAGTGCAATGGG - Intronic
982204433 4:152987035-152987057 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
982220655 4:153122325-153122347 TGCCCAGGCTGGAGTACACTGGG - Intergenic
982445160 4:155482681-155482703 TGTCCAGGCTGCAGTGCAATAGG + Intergenic
983012778 4:162568848-162568870 TGTCCAGGCTAGAGTACAGTAGG + Intergenic
983219291 4:165029097-165029119 TGCCCAGGCTGGAGTGCAATCGG - Intergenic
983858885 4:172679368-172679390 TGCCCAGGCTGGAGTGCAATGGG - Intronic
984787546 4:183582956-183582978 TGCCCAGGCTGGAGTGCAATAGG + Intergenic
985730874 5:1548036-1548058 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
986237593 5:5926643-5926665 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
986827221 5:11534562-11534584 TGTTCAAGCTGGAGTGCAATGGG - Intronic
987175247 5:15301659-15301681 TGTACCTGCTTGAGTAAAGTGGG + Intergenic
987631666 5:20480456-20480478 TGCCCAGGCTGGAGTGCAATGGG + Intronic
987932784 5:24424317-24424339 TGTCCAGGCTGGAGAGCAATGGG + Intergenic
988112341 5:26838880-26838902 GGTACAGTCTTGAGTAAAAAGGG + Intergenic
988183969 5:27835899-27835921 TGCCCAGGCTGGAGTACAATGGG - Intergenic
988326690 5:29777721-29777743 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
989074142 5:37544713-37544735 TGTAAAGCCTTGAGTATAGTTGG + Intronic
989122642 5:38019826-38019848 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
989409623 5:41103679-41103701 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
989477716 5:41893153-41893175 CCTCCAGGCTGGAGTACAATGGG - Intergenic
989598913 5:43183592-43183614 TGCCCAAGCTGGAGTACAATGGG - Intronic
990131908 5:52596517-52596539 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
990290158 5:54341729-54341751 TGCTCAGGCTGGAGTGCAATGGG - Intergenic
990411427 5:55544872-55544894 TGCCCAGGCTGGAGTGCAATTGG + Intergenic
990557229 5:56949310-56949332 TATGCAGGCTGGAGTGCAATGGG - Intronic
990608486 5:57434260-57434282 TTCACAGACTTGAGTACAATAGG - Intergenic
990678429 5:58214650-58214672 TGTCCAGGCTGGAGTGCAAGTGG - Intergenic
991081479 5:62605774-62605796 TGTCCAGGTTGGAGTGCAATGGG + Intronic
991291738 5:65039668-65039690 TGAAAAGGGTTGTGTACAATAGG + Intergenic
991366708 5:65876256-65876278 TGCACAGGCTGGAGTACAACTGG + Intergenic
991580734 5:68152528-68152550 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
992198409 5:74361918-74361940 AGCACAGGCTTGAGAACAATGGG - Intergenic
992265180 5:75011665-75011687 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
992555270 5:77896861-77896883 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
992592831 5:78313368-78313390 TGTTCAGGCTGGAGTGCAATGGG - Intergenic
992797501 5:80266237-80266259 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
992803264 5:80312574-80312596 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
992858922 5:80892196-80892218 TGTACAGATTCGAGTCCAATTGG + Intergenic
995866325 5:116695537-116695559 TGGCCAGGCTGGAGTACAAATGG - Intergenic
996247279 5:121280338-121280360 TGGTCAGGCTGGAGTGCAATGGG - Intergenic
996731365 5:126720840-126720862 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
996890696 5:128416065-128416087 TGCCCAGGCTGGAGTGCAATGGG + Intronic
997314030 5:132916959-132916981 TGCCCAGGCTGGAGTGCAATGGG + Intronic
997333422 5:133084846-133084868 TGCCCAGGCTGGAGTGCAATGGG + Intronic
997352765 5:133242637-133242659 TCCACAGGCTGGAGTACCATAGG + Intronic
997537857 5:134636499-134636521 TGCCCAGGCTGGAGTGCAATGGG + Intronic
997935521 5:138107098-138107120 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
997961318 5:138323915-138323937 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
998015717 5:138730492-138730514 TGCCCAGGCTGGAGTACAATGGG + Intronic
998120959 5:139577452-139577474 TGCCCAGGCTGGAGTGCAATGGG + Intronic
998235182 5:140392448-140392470 TGCCCAGGCTGGAGTCCAATGGG - Intergenic
999321364 5:150617334-150617356 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1000036269 5:157450661-157450683 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1000108332 5:158082335-158082357 TTTACAGCCTTGAGAAGAATGGG + Intergenic
1000293823 5:159895726-159895748 TGTAAAGCCTTGAATACATTTGG - Intergenic
1000723527 5:164738510-164738532 TATCCAGGCTGGAGTGCAATGGG - Intergenic
1000955047 5:167533348-167533370 TGTACAGGCTTGAGTACAATGGG + Intronic
1001205343 5:169756882-169756904 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1001830791 5:174787770-174787792 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1002029904 5:176420138-176420160 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1002141038 5:177139208-177139230 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1003511771 6:6787473-6787495 TGCCCAGGCTGGAGTACAATGGG + Intergenic
1003603017 6:7535499-7535521 TGCCCAGGCTGGAGTTCAATGGG - Intergenic
1004297926 6:14430989-14431011 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1004404224 6:15317034-15317056 TAGACAGTCTTGAGTATAATGGG + Intronic
1004542272 6:16562330-16562352 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1004696086 6:18034163-18034185 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1005339027 6:24825964-24825986 TGTCCAGGCTGGAGTGCAAATGG + Intronic
1005578705 6:27213419-27213441 TGACCAGGCTGGAGTTCAATGGG - Intergenic
1005899461 6:30205199-30205221 TGCCCAGGCTGGAGTGCAATTGG - Intronic
1005934207 6:30507470-30507492 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1006367714 6:33625268-33625290 TGCCCAGGCTGGAGTACAATGGG + Intronic
1007588154 6:43005321-43005343 TGTTCAGGCTGGAGTGCAGTTGG + Intronic
1007660198 6:43479625-43479647 TGCCCAGGCTGGAGTACAATGGG - Intronic
1008763610 6:54883373-54883395 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1009020128 6:57939995-57940017 TTTATAGGCTTGAGAACAACAGG + Intergenic
1009424948 6:63503873-63503895 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
1010139437 6:72597521-72597543 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1010481944 6:76365999-76366021 TGGAATGGTTTGAGTACAATTGG + Intergenic
1010611383 6:77957762-77957784 TGTCCAGGCTGGAGTGCAGTTGG - Intergenic
1010886452 6:81248579-81248601 TGTCCAGGCTGGAGTGCAATGGG - Intergenic
1010978062 6:82339141-82339163 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1011686438 6:89827791-89827813 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1012381359 6:98623445-98623467 TTTACAGCATTGAATACAATCGG - Intergenic
1012711822 6:102616753-102616775 TGTACAGGTTCCAGTACAATTGG - Intergenic
1012721173 6:102747789-102747811 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1013066607 6:106690096-106690118 TGTCCAGGCTGGAGTGCAAATGG + Intergenic
1013114258 6:107089095-107089117 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1013247627 6:108301984-108302006 TGCCCAGGCTGGAGTGCAATTGG + Intronic
1013691407 6:112648998-112649020 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1013985952 6:116194004-116194026 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1015546630 6:134368293-134368315 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1016719244 6:147274299-147274321 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1016814724 6:148293013-148293035 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1017248362 6:152252229-152252251 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1017545983 6:155451017-155451039 TGCCCAGGCTGGAGTACAATGGG + Intronic
1017668510 6:156746319-156746341 CGCCCAGGCTGGAGTACAATGGG + Intergenic
1018229054 6:161657973-161657995 TGATCAGGCTGGAGTGCAATGGG - Intronic
1019821630 7:3248024-3248046 TGTCCAGGCTGGAGTGCAGTGGG - Intergenic
1019945439 7:4325048-4325070 TGTCCAGGCTGGAGTGCAGTTGG - Intergenic
1020267036 7:6567761-6567783 TGCCCAGGCTGGAGTGCAATTGG - Intergenic
1020416418 7:7951245-7951267 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1021035006 7:15786693-15786715 TGCCCAGGCTGGAGTACAAATGG + Intergenic
1021293631 7:18876741-18876763 TGTCCAGGCTGGAGCACAGTGGG + Intronic
1021882239 7:25106261-25106283 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1023410644 7:39886055-39886077 TACACAGGCTGGAGTGCAATGGG - Intergenic
1023413768 7:39912983-39913005 TGCCCAGGCTGGAGTACACTGGG - Intergenic
1023435760 7:40139082-40139104 CGCCCAGGCTGGAGTACAATGGG - Intronic
1023623248 7:42093336-42093358 TGCCCAGGCTGGAGTGCAATAGG - Intronic
1023918980 7:44612421-44612443 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1024645271 7:51365863-51365885 TGTCCAGGCTGGAGTGCAATGGG + Intergenic
1024925962 7:54616286-54616308 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1025769622 7:64491796-64491818 TGCCCAGGCTTGAGTGCAGTGGG - Intergenic
1025815683 7:64908948-64908970 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1025826567 7:65015546-65015568 TGCTCAGGCTGGAGTACAGTGGG - Intergenic
1025863798 7:65360660-65360682 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1025871388 7:65437641-65437663 TCTCCAGGCTGGAGTGCAATGGG - Intergenic
1026056257 7:66986512-66986534 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1026195534 7:68170299-68170321 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1026330715 7:69350087-69350109 TGCCCAGGCTGGAGTACAAGTGG - Intergenic
1026480769 7:70777367-70777389 TGCCCAGGCTGGAGTACAAGGGG + Intronic
1026777896 7:73242540-73242562 TACCCAGGCTGGAGTACAATGGG - Intergenic
1026862812 7:73803808-73803830 CGTCCAGGCTGGAGTGCAATGGG - Intronic
1026993637 7:74601901-74601923 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1026997092 7:74624560-74624582 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1027018748 7:74795933-74795955 TACCCAGGCTGGAGTACAATGGG - Intergenic
1027394257 7:77737980-77738002 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1027709129 7:81575283-81575305 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1027838500 7:83278059-83278081 AGTTCAGGCTTCAGGACAATGGG + Intergenic
1028538811 7:91920109-91920131 TGTCCTGGCTGGAGTACAGTGGG - Intergenic
1028918053 7:96281348-96281370 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1029268115 7:99358580-99358602 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1029377350 7:100187504-100187526 TGTACAGGCCTGGGTACTTTTGG + Intronic
1029517550 7:101035522-101035544 TGAACAGGCTTCAGTAGAAGTGG - Exonic
1029517789 7:101037643-101037665 TGAACTGGCTTCAGTAGAATTGG - Exonic
1029517825 7:101037994-101038016 TGAACGGGCTTCAGTAGAATTGG - Exonic
1029884757 7:103856526-103856548 TGCCCAGGCTGGAGTTCAATGGG - Intronic
1030045015 7:105487018-105487040 TATCCAGGCTGGAGTACAAGTGG - Intronic
1031046039 7:116888787-116888809 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1032041442 7:128566152-128566174 TGCCCAGGCTGGAGTACAAATGG + Intergenic
1032282114 7:130512269-130512291 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1032500448 7:132395860-132395882 TGTACAGGCATAGGTATAATGGG - Intronic
1032513593 7:132491182-132491204 TTTACAGGCACGAGTGCAATAGG - Intronic
1032604833 7:133338792-133338814 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1032696342 7:134339919-134339941 TGCCCAGGCTGGAGGACAATGGG + Intergenic
1032828427 7:135595973-135595995 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1033357193 7:140609470-140609492 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1033516386 7:142110960-142110982 TGTCCAGGCTGGAGTGCAATAGG + Intergenic
1034058311 7:148059547-148059569 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1034170838 7:149061742-149061764 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1034250349 7:149685511-149685533 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1034574663 7:151986766-151986788 TGCCCAGGCTAGAGTGCAATGGG + Intronic
1034663806 7:152797131-152797153 TGCACAGGCTGGAGTGCAGTGGG + Intronic
1036374398 8:8187978-8188000 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1036458024 8:8926544-8926566 TGCTCAGGCTGGAGTGCAATGGG - Intergenic
1036714366 8:11106808-11106830 TGCCCAGGCTGGAGTACAAGTGG - Intronic
1036732955 8:11282350-11282372 TGTACAGGTTCCAGTCCAATTGG + Intergenic
1036876505 8:12477657-12477679 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1037650651 8:20835437-20835459 TGCCCAGGCTGGAGTACAGTGGG - Intergenic
1037927628 8:22856673-22856695 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1038169763 8:25119714-25119736 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1038286609 8:26211207-26211229 TGCCCAGGCTGGAGTGCAATTGG + Intergenic
1039345146 8:36695269-36695291 TGTACAGGACTAAGTTCAATTGG - Intergenic
1039597143 8:38800118-38800140 TGTCCAGGCTGGAGTACAGTGGG - Intronic
1039705420 8:40001825-40001847 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1039813471 8:41070937-41070959 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1039814644 8:41082459-41082481 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1039998838 8:42559574-42559596 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1040474109 8:47761954-47761976 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1040931187 8:52736880-52736902 CGCTCAGGCTGGAGTACAATTGG - Intronic
1041040382 8:53840455-53840477 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1041253081 8:55953604-55953626 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1041515180 8:58691823-58691845 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1041775093 8:61514666-61514688 CGCCCAGGCTGGAGTACAATGGG - Intronic
1042596176 8:70450618-70450640 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1042720960 8:71826670-71826692 CGTCCAGGCTGGAGAACAATGGG + Intergenic
1042902478 8:73743511-73743533 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1042916008 8:73876924-73876946 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1043259208 8:78176514-78176536 TGTACAGGTTCCAGTTCAATTGG + Intergenic
1043662561 8:82762986-82763008 TGCACAGGCTGGAGTGCAATGGG + Intergenic
1043855255 8:85257667-85257689 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1044158895 8:88887879-88887901 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1044391073 8:91651900-91651922 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1044652720 8:94515134-94515156 TGCACAGGCTGGAGTACAAAGGG + Intronic
1044679039 8:94758773-94758795 TGCCCAGGCTGGAGTACAGTGGG + Intronic
1045455278 8:102372024-102372046 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1045503488 8:102761304-102761326 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1045593875 8:103630537-103630559 TGCCCAGGCTAGAGTGCAATGGG - Intronic
1045624951 8:104034509-104034531 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1045642485 8:104266962-104266984 TGTCCAGGCTGGAGTGCAATGGG - Intergenic
1046389248 8:113546911-113546933 TGTCCAGGCTGGAGTGCAGTGGG + Intergenic
1046668392 8:117031498-117031520 TGCCCAGGCTGGAGTGCAATTGG + Intronic
1046769388 8:118103110-118103132 TGCCCAGGCTGGAGTGCAATAGG - Intronic
1047799114 8:128290382-128290404 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1047852381 8:128871412-128871434 TGTACAGGTTTCATCACAATAGG + Intergenic
1049552199 8:143265526-143265548 TGCCCAGGCTGGAGTGCAATTGG - Intronic
1049928202 9:430331-430353 TGTCCAGGCTGGAGTGAAATGGG - Intronic
1049977177 9:871074-871096 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1050213245 9:3289510-3289532 TGTACAAGCTGGAGGACAGTAGG + Intronic
1050228223 9:3486082-3486104 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1050351284 9:4742650-4742672 TGCCCAGGCTGGAGTGCAATCGG + Intergenic
1050373428 9:4946132-4946154 TGCACAGGCTGGAGAGCAATGGG + Intergenic
1050719973 9:8577293-8577315 TGCCCAGGCTGGAGTACAATTGG + Intronic
1050903854 9:10979016-10979038 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1051421098 9:16890256-16890278 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1051594402 9:18809746-18809768 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1051633977 9:19165112-19165134 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1051670654 9:19506532-19506554 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1052466434 9:28836353-28836375 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1053435733 9:38072972-38072994 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
1055871005 9:80879693-80879715 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1056209148 9:84348946-84348968 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1056214213 9:84392972-84392994 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1056371818 9:85963309-85963331 TGCCCAGGTTGGAGTACAATGGG + Intronic
1056394708 9:86171104-86171126 CGCCCAGGCTGGAGTACAATGGG + Intergenic
1056990899 9:91409809-91409831 TGCACATGCTTGAGTTCAACTGG + Exonic
1057737695 9:97680247-97680269 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1057755977 9:97835871-97835893 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1057885875 9:98829227-98829249 TGCCCAGGCTAGAGTACAGTAGG + Intronic
1057891480 9:98873298-98873320 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1057965011 9:99494071-99494093 TGCCCAGGCTGGAGTGCAATAGG - Intergenic
1058440291 9:105000531-105000553 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1058483851 9:105423423-105423445 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1059028905 9:110668148-110668170 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1059353561 9:113683175-113683197 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1059467119 9:114476003-114476025 TGCTCAGGCTAGAGTACAATGGG + Intronic
1060571109 9:124641316-124641338 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1060632616 9:125173364-125173386 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1060649682 9:125314611-125314633 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1060673147 9:125488404-125488426 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1060800595 9:126542652-126542674 TGCCCAGGCTAAAGTACAATGGG - Intergenic
1061608606 9:131730652-131730674 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1061697733 9:132390014-132390036 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1061718982 9:132539970-132539992 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1061986601 9:134133715-134133737 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1203520217 Un_GL000213v1:38388-38410 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1203729531 Un_GL000216v2:78200-78222 TGGAAAGGATTGAATACAATGGG - Intergenic
1185477313 X:423119-423141 TGTGTAGGCTGGAGTACAGTGGG + Intergenic
1185477360 X:423416-423438 TGCCCAGGCTAGAGTGCAATGGG + Intergenic
1185494875 X:546624-546646 CGTCCAGGCTGGAGTGCAATGGG - Intergenic
1186418135 X:9401107-9401129 TGCCCAGGCTAGAGTGCAATGGG - Intergenic
1186553558 X:10532806-10532828 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1187123193 X:16429108-16429130 TGCCCAGGCTGGAGTACAGTAGG + Intergenic
1188268354 X:28106900-28106922 TGTACTGGGTTGAGAAAAATGGG - Intergenic
1188407527 X:29830488-29830510 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1188484800 X:30670940-30670962 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1188956256 X:36437544-36437566 AGTTCAGGCTTCAGGACAATAGG - Intergenic
1189112706 X:38310017-38310039 TGCCCAGGCTTGAGTGCAGTGGG + Intronic
1189315828 X:40055860-40055882 TGTCCAGGCTGGAGTGCAGTGGG + Intronic
1189828390 X:44944309-44944331 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1189971872 X:46426111-46426133 TGCCCAGACTGGAGTACAATGGG + Intergenic
1190099852 X:47514219-47514241 TGCTCAGGCTGGAGTACAGTGGG + Intergenic
1190358315 X:49626450-49626472 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1190834817 X:54090653-54090675 TGTACAGTTTTCAGAACAATGGG + Intronic
1190877846 X:54472235-54472257 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1192430740 X:71109887-71109909 TGCCCAGGCTTGAGTGCAGTGGG - Intronic
1192972462 X:76248047-76248069 TGGAATGGTTTGAGTACAATTGG + Intergenic
1193123638 X:77848971-77848993 TGCCCAGGCTTGAGTACAGTGGG - Intronic
1193803520 X:85966306-85966328 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1194296552 X:92133405-92133427 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1194440158 X:93922229-93922251 TGTCCAGGCTGGAGTACTGTGGG - Intergenic
1194453052 X:94068892-94068914 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1195034202 X:100956399-100956421 TGCACAGGCTGGAGTGCAGTAGG - Intergenic
1195646617 X:107237938-107237960 TGCCCAGGCTGGAGTACAGTGGG - Intronic
1196193491 X:112817604-112817626 TGTACAGGTTTGAGGACTCTTGG - Intronic
1196434385 X:115661652-115661674 TGCTCAGGCTGGAGTGCAATGGG - Intergenic
1196713998 X:118793757-118793779 TCTACAGGTTTGGGTACAAGTGG + Exonic
1196721465 X:118858475-118858497 TGCCCAGGCTGGAGTACAGTGGG + Intergenic
1196785180 X:119415652-119415674 TGCCCAGGCTGGAGTGCAATGGG - Intronic
1196849456 X:119923911-119923933 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1197205266 X:123784270-123784292 TGCCCAGGCTGGAGTGCAATGGG - Intergenic
1197777910 X:130131910-130131932 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1198110415 X:133498028-133498050 TGCCCAGGCTGGAGTGCAATGGG + Intergenic
1198149124 X:133890817-133890839 TGTCCAGGCTGGAGTGCAGTGGG - Intronic
1199201856 X:145100019-145100041 TGGACAGTCTTCAGTACAACTGG + Intergenic
1199910689 X:152283571-152283593 TGTGCAGGATGGAGTACAAAGGG - Intronic
1200614062 Y:5357975-5357997 TGCCCAGGCTGGAGTGCAATGGG + Intronic
1200822347 Y:7599879-7599901 TGCCCAGGCTGGAGTACAATGGG + Intergenic
1200877360 Y:8172014-8172036 TGCCCAGGCTGGAGTCCAATAGG + Intergenic
1201056319 Y:9995700-9995722 TGCCCAGGCTGGAGTACAATGGG - Intergenic
1202104359 Y:21347136-21347158 TGCCCAGGCTGGAGTACAATGGG + Intergenic
1202237954 Y:22734138-22734160 TGCCCAGGCTGGAGTACAATGGG - Intergenic