ID: 1000956986

View in Genome Browser
Species Human (GRCh38)
Location 5:167554905-167554927
Sequence CAGAGTAGACAGATGCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000956973_1000956986 17 Left 1000956973 5:167554865-167554887 CCTCCTCCTCCTCCTCCTCCTCC 0: 1901
1: 5100
2: 10705
3: 16594
4: 27534
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956980_1000956986 -4 Left 1000956980 5:167554886-167554908 CCAACCTGTTCCAATTGCTCAGA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956978_1000956986 2 Left 1000956978 5:167554880-167554902 CCTCCTCCAACCTGTTCCAATTG 0: 1
1: 0
2: 0
3: 15
4: 213
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956975_1000956986 11 Left 1000956975 5:167554871-167554893 CCTCCTCCTCCTCCTCCAACCTG 0: 1
1: 4
2: 63
3: 544
4: 4230
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956974_1000956986 14 Left 1000956974 5:167554868-167554890 CCTCCTCCTCCTCCTCCTCCAAC 0: 8
1: 104
2: 2836
3: 8321
4: 18436
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956981_1000956986 -8 Left 1000956981 5:167554890-167554912 CCTGTTCCAATTGCTCAGAGTAG 0: 1
1: 0
2: 1
3: 4
4: 111
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956976_1000956986 8 Left 1000956976 5:167554874-167554896 CCTCCTCCTCCTCCAACCTGTTC 0: 1
1: 1
2: 16
3: 176
4: 2205
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956977_1000956986 5 Left 1000956977 5:167554877-167554899 CCTCCTCCTCCAACCTGTTCCAA 0: 1
1: 0
2: 5
3: 54
4: 527
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data
1000956979_1000956986 -1 Left 1000956979 5:167554883-167554905 CCTCCAACCTGTTCCAATTGCTC 0: 1
1: 0
2: 1
3: 42
4: 608
Right 1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000956986 Original CRISPR CAGAGTAGACAGATGCTTGG GGG Intronic
No off target data available for this crispr